BBa_K1592007 1 Si-tag1 LIP prepro + E. coli ribosomal protein L2 (1-60aa) + YLcwp3 Fusion 2015-09-04T11:00:00Z 2015-09-18T09:26:29Z E. coli ribosomal protein L2 was synthesized by IDT. LIP2 prepro and YLcwp3 were cloning from the plasmid JMP62 of our lab. This is the cell display fusion protein of Yarrowia lipolytica, composed of LIP prepro, interest protein, and YLcwp3. LIP prepro is signal peptide used to secrete the interest protein out of the cell, and the YLcwp3 is the anchor domain binding the interest protein to the cell wall of yeast. We use this system to display silica-tag and test its binding characteristics. E.coli ribosomal protein L2 was found to bind tightly to silicon particles, which have surfaces that are oxidized to silica. This L2 silica-binding tag, called the ??????Si-tag,?????? can be used for one-step targeting of functional proteins on silica surfaces. The silica-binding domains of E. coli L2 was mapped to amino acids 1???60, 61-202 and 203???273. We respectively test the silica-binding characteristics of this three regions and their combinations. E. coli ribosomal protein L2 (1-60) is the amino acids 1???60 of E. coli ribosomal protein L2, we call it si-tag1. false false _2009_ 20267 20267 9 Not in stock true In order to replace more convenient, we respectively added BamHI, SalI, NdeI between LIP2 prepro, E. coli ribosomal protein L2 (1-60), GS linker, YLcwp3. false Shuyan Tang annotation2444370 1 BBa_K1592000 range2444370 1 1 99 annotation2447678 1 his-tag range2447678 1 106 123 annotation2444372 1 Si-tag1 range2444372 1 124 303 annotation2444373 1 SalI range2444373 1 304 309 annotation2444391 1 LIP2 prepro range2444391 1 1 99 annotation2444390 1 BBa_K1592002 range2444390 1 343 708 annotation2444389 1 YLcwp3 range2444389 1 343 708 annotation2444388 1 NdeI range2444388 1 337 342 annotation2444371 1 BamHI range2444371 1 100 105 annotation2444387 1 GS linker range2444387 1 310 336 BBa_K1592007_sequence 1 atgaagctttccaccatccttttcacagcctgcgctaccctggctgccgccctcccttcccccatcactccttctgaggccgcagttctccagaagcgaggatcccaccaccaccaccaccacatggcagttgttaaatgtaaaccgacatctccgggtcgtcgccacgtagttaaagtggttaaccctgagctgcacaagggcaaaccttttgctccgttgctggaaaaaaacagcaaatccggtggtcgtaacaacaatggccgtatcaccactcgtcatatcggtggtggccacaagcaggtcgacggcggcggcggctctggcggcggcggctctggcggcggcggctctcatatgctcggctttgccgctcgagctgtcttcgaaggtggctcttcttccgccgctgctcccacctcttcctccgctgcttcccatgccgcctcttccgctgccgcctctgcttctcacgctgcttcttctgctgctgcttccaaggcttcttctgctgttgccgcccccaagtccgaggccgctgctggtgctcacgccactgccggtgccattgtctcccagatcaatgatggccagatccaggctccccactccaccggccctgcccaggcccccaaggcctctgctcctcccgcccaggccaacggcgctgccacccttggtgtctctgctgttgccggtgctgttgccgtcgccatgcttttctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z