BBa_K1592008 1 Si-tag2 LIP prepro + E. coli ribosomal protein L2 (61-202aa) + YLcwp3 Fusion 2015-09-05T11:00:00Z 2015-09-18T09:45:18Z E. coli ribosomal protein L2 was synthesized by IDT, LIP2 prepro and YLcwp3 were cloning from the plasmid JMP62, and we fused this three sequences. This is the cell display system of Yarrowia lipolytica, composed of LIP2 prepro, interest protein, and YLcwp3.LIP prepro is signal peptide used to secrete the interest protein out of the cell, and the YLcwp3 is the anchor domain binding the interest protein to the cell wall of yeast. We use this system to display silica-tag and test its binding characteristics. E.coli ribosomal protein L2 was found to bind tightly to silicon particles, which have surfaces that are oxidized to silica. This L2 silica-binding tag, called the ??????Si-tag,?????? can be used for one-step targeting of functional proteins on silica surfaces. The silica-binding domains of E. coli L2 was mapped to amino acids 1???60, 61-202 and 203???273, called Si-tag1, Si-tag2, Si-tag3. We respectively test the silica-binding characteristics of this three regions and their combinations. false false _2009_ 20267 20267 9 Not in stock true In order to replace the domains more conveniently, we added BamHI, SalI, NdeI, NdeI between LIP2 prepro, E. coli ribosomal protein L2, GS linker and YLcwp3. false Shuyan Tang annotation2456109 1 NdeI range2456109 1 601 606 annotation2456110 1 YLcwp3 range2456110 1 607 972 annotation2456026 1 SalI range2456026 1 550 555 annotation2456104 1 GS Linker range2456104 1 556 600 annotation2455957 1 Si-tag 2 range2455957 1 124 549 annotation2455913 1 HIs6 tag range2455913 1 106 123 annotation2455910 1 LIP2 prepro range2455910 1 1 99 annotation2455912 1 BamHI range2455912 1 100 105 BBa_K1592008_sequence 1 atgaagctttccaccatccttttcacagcctgcgctaccctggctgccgccctcccttcccccatcactccttctgaggccgcagttctccagaagcgaggatcccaccaccaccaccaccacgcttaccgtattgttgacttcaaacgcaacaaagacggtatcccggcagttgttgaacgtcttgagtacgatccgaaccgttccgcgaacatcgcgctggttctgtacaaagacggtgaacgccgttacatcctggcccctaaaggcctgaaagctggcgaccagattcagtctggcgttgatgctgcaatcaaaccaggtaacaccctgccgatgcgcaacatcccggttggttctactgttcataacgtagaaatgaaaccaggtaaaggcggtcagctggcacgttccgctggtacttacgttcagatcgttgctcgtgatggtgcttatgtcaccctgcgtctgcgttctggtgaaatgcgtaaagtagaagcagactgccgtgcaactctgggcgaagttggcaatgctgagcatatgctggtcgacggcggcggcggctctggcggcggcggctctggcggcggcggctctcatatgctcggctttgccgctcgagctgtcttcgaaggtggctcttcttccgccgctgctcccacctcttcctccgctgcttcccatgccgcctcttccgctgccgcctctgcttctcacgctgcttcttctgctgctgcttccaaggcttcttctgctgttgccgcccccaagtccgaggccgctgctggtgctcacgccactgccggtgccattgtctcccagatcaatgatggccagatccaggctccccactccaccggccctgcccaggcccccaaggcctctgctcctcccgcccaggccaacggcgctgccacccttggtgtctctgctgttgccggtgctgttgccgtcgccatgcttttctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z