BBa_K1592009 1 Si-tag3 LIP2 prepro + E. coli ribosomal protein L2 (203-273aa) + YLcwp3 Fusion 2015-09-05T11:00:00Z 2015-09-18T09:27:28Z E. coli ribosomal protein L2 was synthesized by IDT, LIP2 prepro and YLcwp3 were cloning from the plasmid JMP62, and we fused this three sequences. This is the cell display system of Yarrowia lipolytica, composed of LIP2 prepro, interest protein, and YLcwp3.LIP prepro is signal peptide used to secrete the interest protein out of the cell, and the YLcwp3 is the anchor domain binding the interest protein to the cell wall of yeast. We use this system to display silica-tag and test its binding characteristics. E.coli ribosomal protein L2 was found to bind tightly to silicon particles, which have surfaces that are oxidized to silica. This L2 silica-binding tag, called the 'Si-tag', can be used for one-step targeting of functional proteins on silica surfaces. The silica-binding domains of E. coli L2 was mapped to amino acids 1???60, 61-202 and 203???273, called Si-tag1, Si-tag2, Si-tag3. We respectively test the silica-binding characteristics of this three regions and their combinations. false false _2009_ 20267 20267 9 true In order to replace the domains more conveniently, we respectivey added BamHI, SalI, NdeI between LIP2 prepro, E. coli ribosomal protein L2, GS linker and YLcwp3. false Shuyan Tang annotation2456121 1 LIP2 prepro range2456121 1 1 99 annotation2456187 1 NdeI range2456187 1 373 378 annotation2456122 1 BamHI range2456122 1 100 105 annotation2456125 1 SalI range2456125 1 340 345 annotation2456123 1 His6 tag range2456123 1 106 123 annotation2456124 1 Si-tag 3 range2456124 1 124 339 annotation2456127 1 YLcwp3 range2456127 1 379 762 annotation2456126 1 GS Linker range2456126 1 346 372 BBa_K1592009_sequence 1 atgaagctttccaccatccttttcacagcctgcgctaccctggctgccgccctcccttcccccatcactccttctgaggccgcagttctccagaagcgaggatcccaccaccaccaccaccaccgcgttctgggtaaagcaggtgctgcacgctggcgtggtgttcgtccgaccgttcgcggtaccgcgatgaacccggtagaccacccacatggtggtggtgaaggtcgtaactttggtaagcacccggtaactccgtggggcgttcagaccaaaggtaagaagacccgcagcaacaagcgtactgataaattcatcgtacgtcgccgtagcaaataagtcgacggcggcggcggctctggcggcggcggctctggcggcggcggctctcatatgctcggctttgccgctcgagctgtcttcgaaggtggctcttcttccgccgctgctcccacctcttcctccgctgcttcccatgccgcctcttccgctgccgcctctgcttctcacgctgcttcttctgctgctgcttccaaggcttcttctgctgttgccgcccccaagtccgaggccgctgctggtgctcacgccactgccggtgccattgtctcccagatcaatgatggccagatccaggctccccactccaccggccctgcccaggcccccaaggcctctgctcctcccgcccaggccaacggcgctgccacccttggtgtctctgctgttgccggtgctgttgccgtcgccatgcttttctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z