BBa_K1592012 1 Si-tag1+3 LIP prepro + E. coli ribosomal protein L2 (1-60,203-273aa) + YLcwp3 Fusion 2015-09-06T11:00:00Z 2015-09-18T09:35:56Z E. coli ribosomal protein L2 was synthesized by IDT, LIP2 prepro and YLcwp3 were cloning from the plasmid JMP62, and we fused this three sequences. __NOTOC__ <partinfo>BBa_K1592008 short</partinfo> This is the cell display system of Yarrowia lipolytica, composed of LIP prepro, interest protein, and YLcwp3.LIP prepro is signal peptide used to secrete the interest protein out of the cell, and the YLcwp3 is the anchor domain binding the interest protein to the cell wall of yeast.We use this system to display silica-tag and test its binding characteristics. Here we use this system to display Silica-tag on cell wall of Yarrowia lipolytica to binding the silica. E.coli ribosomal protein L2 was found to bind tightly to silicon particles, which have surfaces that are oxidized to silica. This L2 silica-binding tag, called the 'Si-tag', can be used for one-step targeting of functional proteins on silica surfaces. The silica-binding domains of E. coli L2 was mapped to amino acids 1???60, 61-202 and 203???273, called Si-tag1, Si-tag2 and Si-tag3. We respectively test the silica-binding characteristics of this three regions and their combinations. false false _2009_ 20267 20267 9 true In order to replace the domains more conveniently, we respectivey added BamHI, SalI, NdeI between LIP2 prepro, E. coli ribosomal protein L2, GS linker and YLcwp3 false Shuyan Tang annotation2456159 1 BamHI range2456159 1 100 105 annotation2456162 1 GS Linker range2456162 1 508 552 annotation2456161 1 SalI range2456161 1 502 507 annotation2456164 1 YLcwp3 range2456164 1 559 924 annotation2456158 1 LIP2 prepro range2456158 1 1 99 annotation2456160 1 Si-tag range2456160 1 106 501 annotation2456163 1 NdeI range2456163 1 553 558 BBa_K1592012_sequence 1 atgaagctttccaccatccttttcacagcctgcgctaccctggctgccgccctcccttcccccatcactccttctgaggccgcagttctccagaagcgaggatccatggcagttgttaaatgtaaaccgacatctccgggtcgtcgccacgtagttaaagtggttaaccctgagctgcacaagggcaaaccttttgctccgttgctggaaaaaaacagcaaatccggtggtcgtaacaacaatggccgtatcaccactcgtcatatcggtggtggccacaagcagcgcgttctgggtaaagcaggtgctgcacgctggcgtggtgttcgtccgaccgttcgcggtaccgcgatgaacccggtagaccacccacatggtggtggtgaaggtcgtaactttggtaagcacccggtaactccgtggggcgttcagaccaaaggtaagaagacccgcagcaacaagcgtactgataaattcatcgtacgtcgccgtagcaaataagtcgacggcggcggcggctctggcggcggcggctctggcggcggcggctctcatatgctcggctttgccgctcgagctgtcttcgaaggtggctcttcttccgccgctgctcccacctcttcctccgctgcttcccatgccgcctcttccgctgccgcctctgcttctcacgctgcttcttctgctgctgcttccaaggcttcttctgctgttgccgcccccaagtccgaggccgctgctggtgctcacgccactgccggtgccattgtctcccagatcaatgatggccagatccaggctccccactccaccggccctgcccaggcccccaaggcctctgctcctcccgcccaggccaacggcgctgccacccttggtgtctctgctgttgccggtgctgttgccgtcgccatgcttttctaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 James Alastair McLaughlin Chris J. Myers 2017-03-06T15:00:00.000Z