BBa_K1592017 1 BBa_K1592017 Mcfp3 with XPR2 pre 2015-09-08T11:00:00Z 2015-09-09T07:26:33Z Synthesized by IDT. Mcfp-3 is foot protein secreted from Mytilus californianus. The protein is of significance to the formation of byssus to help mussels permanently or temporarily tether to the surface of solid surface of reef or ship-body. This coherent substance shows the excellent adhesion performance with no substitute under water for sustaining the repeating wash of waves and having no toxicity. XPR2 pre is the pre-region corresponds to the signal sequence: the dipeptides XA and XP are substrates for diamino-peptidase; the dibasic KR cleavage site is substrate for Xpr6p endoproteinase (Matoba and Ogrydziak, 1989). The signal tag, XPR2 fused to Mcfp3 can lead the co-translational translocation of heterologous protein Mcfp-3 to be secreted out of the cell to achieve its function, during the progress of which the peptide will be deleted in the Golgi apparatus to eliminate the interference to the secreting protein. false false _2009_ 20267 20267 9 false none false Shuyan Tang annotation2456118 1 start range2456118 1 46 48 annotation2456116 1 XPR2 signal peptide range2456116 1 1 45 annotation2456119 1 stop range2456119 1 277 279 annotation2456117 1 MCFP3 range2456117 1 46 279 BBa_K1592017_sequence 1 atgaagctcgctaccgcctttactattctcacggccgttctggccatgaataaattcagtgtcacagttttgctggctttagtccttattggattttttgccgttcagagtgacgcaggttatggttatgatctaggatataatgcaccatggccatacaacaatggttactatggctataatggatacaatggatatcacggacgttatggctggaataaaggctggaataacggtccatggggaggatcatattatggaaacaaaggctatttgtat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z