BBa_K1593666 1 SCVE SARS Coronavirus Envelope Protein 2015-08-13T11:00:00Z 2015-09-03T07:52:18Z Synthesis directly This part is SARS Coronavirus Envelope Protein, abbreviated as SCVE. The protein will improve the bactial permeability, which is one of the strategy of permeability improvement originally inplemented in USTC 2015. false false _2010_ 27877 23629 9 false Extract from SARS Coronavirus Envelope Protein false Juntao Yu BBa_K1593667 1 BBa_K1593667 T7-SCVE 2015-08-13T11:00:00Z 2015-09-07T10:01:36Z Synthesize directly or request from parts. This circuit containing strong expression of SCVE regulated by T7, which will significantly improve bacterial permeability. false false _2010_ 23629 23629 9 false No more information false Juntao Yu component2445823 1 BBa_B0034 component2445821 1 BBa_I712074 component2445824 1 BBa_K1593666 annotation2445824 1 BBa_K1593666 range2445824 1 73 300 annotation2445823 1 BBa_B0034 range2445823 1 55 66 annotation2445821 1 BBa_I712074 range2445821 1 1 46 BBa_I712074 1 BBa_I712074 T7 promoter (strong promoter from T7 bacteriophage) 2007-10-21T11:00:00Z 2015-08-31T04:07:46Z T7 bacteriophage T7 promoter is very specific promoter which is transcribed only by specific T7 RNA polymerase. Usually this promoter is used in expression systems where T7 promoter is cotransfected with T7 RNA polymerase. That ensures strong transcription of desired genes. false false _130_ 0 1856 9 In stock false true Rok Gaber BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_B0034_sequence 1 aaagaggagaaa BBa_K1593666_sequence 1 atgtatagctttgtgagcgaagaaaccggcaccctgattgtgaacagcgtgctgctgtttctggcgtttgtggtgtttctgctggtgaccctggcgattctgaccgcgctgcgcctgtgcgcgtattgctgcaacattgtgaacgtgagcctggtgaaaccgaccgtgtatgtgtatagccgcgtgaaaaacctgaacagcagcgaaggcgtgccggatctgctggtg BBa_I712074_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgca BBa_K1593667_sequence 1 taatacgactcactatagggaatacaagctacttgttctttttgcatactagagaaagaggagaaatactagatgtatagctttgtgagcgaagaaaccggcaccctgattgtgaacagcgtgctgctgtttctggcgtttgtggtgtttctgctggtgaccctggcgattctgaccgcgctgcgcctgtgcgcgtattgctgcaacattgtgaacgtgagcctggtgaaaccgaccgtgtatgtgtatagccgcgtgaaaaacctgaacagcagcgaaggcgtgccggatctgctggtg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z