BBa_K1593997 1 BBa_K1593997 R0010-RBS-cheZ 2015-09-02T11:00:00Z 2016-01-25T11:27:48Z The promotor comes from the part,BBa_R0010.The cheZ comes from the genomic sequence of PAO1. This part is used to coding a chemotactci protein,cheZ,downstream of lac promotor. false false _2010_ 4206 27877 9 It's complicated false We use the lac promotor to control the expression of cheZ,in this way,we can control the quantitly of expressed cheZ . false Yuting Liu component2443334 1 BBa_K1593998 component2443333 1 BBa_B0034 component2443325 1 BBa_R0010 annotation2443334 1 BBa_K1593998 range2443334 1 229 912 annotation2443333 1 BBa_B0034 range2443333 1 209 220 annotation2443325 1 BBa_R0010 range2443325 1 1 200 BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1593998 1 BBa_K1593998 overexpress cheZ 2015-09-02T11:00:00Z 2015-09-03T08:10:44Z It comes from the genomic sequence of PAO1. this part is uesd for coding cheZ,a chemotactic protein. false false _2010_ 27877 27877 9 It's complicated false We construct this part to overexpress a chemotactic protein cheZ,which can improve the motility of bacteria. false Yuting Liu BBa_R0010 1 LacI promoter (lacI regulated) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z The Plac insert was PCR'd from the MG1655 strain of E.coli K12. Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The pLac regulatory region is a 243 base-pair sequence with standard BioBrick prefix and suffix sections on its ends. It contains two protein binding sites: CAP, which is generally present in E.coli and is assocciated with cell health and availability of glucose., and LacI, the Lac inhibitor <bb_part>BBa_C0010</bb_part> which binds in an dimerized cooperative manner to inhibit the transcription of the protein that follows. In the presence of lactose or IPTG, an analog of lactose, LacI is unable to correctly bind and inhibit transcription. This allows <bb_part>BBa_R0010</bb_part> to be used as a inverter or as a detector of lactose or IPTG. false true _1_ 0 24 7 In stock false <P> <P><P> LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and this regulator. This part is incompatible with environments containing lactose or lactose analogs. true annotation1961223 1 CAP binding site range1961223 1 89 126 annotation1961222 1 BBa_R0010 range1961222 1 1 200 annotation1961227 1 start range1961227 1 173 173 annotation1961225 1 -10 range1961225 1 161 166 annotation1961226 1 LacI binding site range1961226 1 166 200 annotation1961224 1 -35 range1961224 1 137 142 annotation1961221 1 end of LacI coding region (inactive) range1961221 1 1 88 BBa_R0010_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacaca BBa_B0034_sequence 1 aaagaggagaaa BBa_K1593997_sequence 1 caatacgcaaaccgcctctccccgcgcgttggccgattcattaatgcagctggcacgacaggtttcccgactggaaagcgggcagtgagcgcaacgcaattaatgtgagttagctcactcattaggcaccccaggctttacactttatgcttccggctcgtatgttgtgtggaattgtgagcggataacaatttcacacatactagagaaagaggagaaatactagaggtgcaattgatccaggagctcagccaggccagggaccgtggcctctaccaggaagtgggcaagctgacccgcgaactgcacaacgccatcgtcgatttccagatcgacccgcattccccccacgcgcaggaaatgtcgcagatcgccgatgccaccgatcgtctttcctacgtagaggaaatgaccgagaaggccgccaaccggaccatggacctggtggagcagagcgccccgctggtcaaccagttgggcgacgattcgcgggagctgcaccaggagtggcaacgcttcatgcgccgggaaatcgacgctgacggcttccgcgagctggccaagcgcatcgaacagttcctcgtgcgcacgggcgagaacgccggccagttgtcctcgcagctcaatgacatcctgctggcgcaggattaccaggacctgaccggccaggtgatcaagcgtgtcaccaagctggtcaccgaggtcgagagcaacctcgtgaagctggtctggatggccggccaggtggaccgttacgccgggatcgagcacgaccacgtgagcatgcgccaccaggccgcgatggagcgttcggccaagggcgaggggccgcaggtcgccgcggaaaaacgagaggatgtggtgtccgggcaggatgacgtggacgatctgctgtccagcctgggtttctga BBa_K1593998_sequence 1 gtgcaattgatccaggagctcagccaggccagggaccgtggcctctaccaggaagtgggcaagctgacccgcgaactgcacaacgccatcgtcgatttccagatcgacccgcattccccccacgcgcaggaaatgtcgcagatcgccgatgccaccgatcgtctttcctacgtagaggaaatgaccgagaaggccgccaaccggaccatggacctggtggagcagagcgccccgctggtcaaccagttgggcgacgattcgcgggagctgcaccaggagtggcaacgcttcatgcgccgggaaatcgacgctgacggcttccgcgagctggccaagcgcatcgaacagttcctcgtgcgcacgggcgagaacgccggccagttgtcctcgcagctcaatgacatcctgctggcgcaggattaccaggacctgaccggccaggtgatcaagcgtgtcaccaagctggtcaccgaggtcgagagcaacctcgtgaagctggtctggatggccggccaggtggaccgttacgccgggatcgagcacgaccacgtgagcatgcgccaccaggccgcgatggagcgttcggccaagggcgaggggccgcaggtcgccgcggaaaaacgagaggatgtggtgtccgggcaggatgacgtggacgatctgctgtccagcctgggtttctga igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z