BBa_K1597000 1 BBa_K1597000 Salt inducible promoter for B. subtilis 2015-09-08T11:00:00Z 2015-09-13T02:51:51Z Bacillus subtilius genomic DNA Bacillus subtilis is capable to cope with fluctuating salt concentrations. One of the genes involved is the proH, this is an 1-pyrroline-5-caboxylate reductase. A studie has shown that this gene is under control of the proH-promoter wich can be activated by a range of salt concentrations. We have cloned this promoter out of the genome of bacillus and combined it with TasA (an amyloid producing gene) and GFP. The latter was used to validate the promoter. false false _2014_ 24529 24529 9 No part sequence false During the design primers were designed to add a prefix and suffix to the promoter. false Marieke Mulder BBa_K1597000_sequence 1 gtctgaatttaaagagattggttttaaaccaaatcatacagaagtataccggtctttgcatgagcttcttgatgacgggatactaaaacaaattaaagtaaaaaaagaaggggctaagctccaggaagtcgtcctctatcaatttaaagattacgaagctgccaagctatataaaaaacagctgaaggtagagctgagctggatcgctgtaaaaaactgattgaaaaagctctctcagataatttttaatagaaacaaacacccggcgcagcagtgtgaaccgggtgttttctgcttttcattatacatatttgtcgaaaagaaacaatacaaatcaataatggccttcaaacttgacatcatttcctcacgtggtaacattttaaacgtgtgaaaatgcgaacaaaaaagcgaacaaaggagatgttaccgatctttgatcaaaagaaagtagcctttataggagcaggatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z