BBa_K1597003 1 BBa_K1597003 bslA, forms hydrophobic surface layer on biofilm 2015-09-13T11:00:00Z 2015-09-14T06:42:56Z Genomic DNA from Bacillus subtilis 168 To make our biofilm more robust and hydrophobic we we have focussed on bslA (K-nummer). bslA forms a hydrophobic surface layer on the biofilm of Bacillus subtilis. This layer is essential for the water repelling properties of the biofilm of the Bacillus subtilis. The BslA protein itself is a cell wall protein with amphiphilic properties which self-assembles into polymers at the air-water interface in vitro. For the expression of bslA, expression of epsABCDEFGHIJKLMNO and tapA-sipW-tasA operons are required. Without bslA the microstructure of the biofilm is smoothened and the repellency against water and organic solvents is reduced. false false _2014_ 24529 24529 9 false We had to change nucleotide 387 from a cytosine into a thymine in order to get rid of an EcoRI restriction site but not change the amino acid sequence false Marieke Mulder annotation2454068 1 bslA range2454068 1 18 563 annotation2454069 1 original RBS from blsA range2454069 1 1 17 BBa_K1597003_sequence 1 ttagggggaattttgttatgaaacgcaaattattatcttctttggcaattagtgcattaagtctcgggttactcgtttctgcacctacagcttctttcgcggctgaatctacatcaactaaagctcatactgaatccactatgagaacacagtctacagcttcattgttcgcaacaatcactggcgccagcaaaacggaatggtctttctcagatatcgaattgacttaccgtccaaacacgcttctcagccttggcgttatggagtttacattgccaagcggatttactgcaaacacgaaagacacattgaacggaaatgccttgcgtacaacacagatcctcaataacgggaaaacagtaagagttcctttggcacttgatttgttaggagctggcgaatttaaattaaaactgaataacaaaacacttcctgccgctggtacatatactttccgtgcggagaataaatcattaagcatcggaaataaattttacgcagaagccagcattgacgtggctaagcgcagcactcctccgactcagccttgcggttgcaactaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z