BBa_K525998 1 pT7 Promoter T7 and RBS 2011-09-12T11:00:00Z 2015-05-08T01:12:35Z Synthesis Released HQ 2013 Promoter T7 and RBS false false _690_ 0 8543 9 In stock false Synthesis false Anna Drong annotation2127788 1 B0034 range2127788 1 21 32 annotation2129432 1 T7 promoter range2129432 1 1 20 annotation2129433 1 RBS range2129433 1 24 27 BBa_K1601000 1 BBa_K1601000 Cytochrome C S.oneidensis without stop codon 2015-09-17T11:00:00Z 2015-09-18T05:25:18Z http://www.ncbi.nlm.nih.gov/gene/1172176 Tuning Promoter Strengths for Improved Synthesis and Function of Electron Conduits in Escherichia coli Cheryl P. Goldbeck,??? Heather M. Jensen,???,?? Michaela A. TerAvest,∥ Nicole Beedle,??? Yancey Appling,??? Matt Hepler,???,?? Guillaume Cambray,⊥,# Vivek Mutalik,???,⊥ Largus T. Angenent,∥ and Caroline M. Ajo-Franklin*,???,??? Came from S.oneidensis Cytochrome C of S.oneidensis, a proteobacterium which can live in both environments with or without oxygen that suggests a cytochrome with high activity. The stop codon has been deleted to facilitate a protein fusion. Udes in breathing, it could help because it is involved in a lot of redox reactions false false _2018_ 26607 26607 9 false use IDT software false Marion Aruanno BBa_K1601016 1 BBa_K1601016 T7 promoteur,RBS - Cytochrome C S.oneidensis - HisTag 2015-09-17T11:00:00Z 2015-09-18T06:00:51Z composed of the biobricks Bba_K525998 BBa_K1601000 Bba_K844000 T7 promoter with RBS and Cytochrome C Shewanella oneidensis. A tag 10xHis is located to the end of the protein (Cterm) to enable its purification false false _2018_ 26607 26607 9 false BBa_K1601000 was optimised by IDT false Marion Aruanno component2474531 1 BBa_K1601000 component2474530 1 BBa_K525998 component2474535 1 BBa_K844000 annotation2474531 1 BBa_K1601000 range2474531 1 33 593 annotation2474530 1 BBa_K525998 range2474530 1 1 32 annotation2474535 1 BBa_K844000 range2474535 1 594 629 BBa_K844000 1 BBa_K844000 10x-Histidine (10x-His) Tag with double stop codon (TAATAA) 2012-10-01T11:00:00Z 2015-05-08T01:13:33Z Constructed through oligonucleotide annealing Released HQ 2013 10x-Histidine tag with double stop codon TAATAA to allow for better extraction of tagged products and protein termination in a single part. false false _1104_ 0 9404 9 In stock true none false Kathleen Miller annotation2206607 1 10x-Histidine Tag range2206607 1 1 30 annotation2206608 1 Stop range2206608 1 31 33 annotation2206609 1 Stop range2206609 1 34 36 BBa_K525998_sequence 1 taatacgactcactatagggaaagaggagaaa BBa_K1601016_sequence 1 taatacgactcactatagggaaagaggagaaaatgaactggcgtgcgctgttcaagccaagcgcaaaatattcgattctggctttgcttgtggtgggcattgttatcggtgttgtggggtatttcgcaacccagcagactttacatgcaacctctaccgacgccttttgcatgtcgtgccatagcaaccattccctgaaaaatgaggttcttgcttccgcacatggcggcgggaaagcgggggtgaccgtgcaatgccaggattgccatctgccacacggcccggtagactatctgattaaaaaaatcattgtttcaaaagatttatacggctttctcactatcgatggattcaatacgcaggcgtggctggacgaaaaccgtaaagaacaggcagacaaagccctcgcctactttcgcggcaatgatagtgccaattgccagcactgtcacacccgtatttatgaaaatcagccggaaaccatgaaacctatggccgtgcgcatgcataccaacaactttaaaaaagatccggaaacgcgtaaaacgtgtgtggattgtcacaagggtgttgcccacccgtatccaaaaggccatcatcaccatcaccaccatcatcaccattaataa BBa_K1601000_sequence 1 atgaactggcgtgcgctgttcaagccaagcgcaaaatattcgattctggctttgcttgtggtgggcattgttatcggtgttgtggggtatttcgcaacccagcagactttacatgcaacctctaccgacgccttttgcatgtcgtgccatagcaaccattccctgaaaaatgaggttcttgcttccgcacatggcggcgggaaagcgggggtgaccgtgcaatgccaggattgccatctgccacacggcccggtagactatctgattaaaaaaatcattgtttcaaaagatttatacggctttctcactatcgatggattcaatacgcaggcgtggctggacgaaaaccgtaaagaacaggcagacaaagccctcgcctactttcgcggcaatgatagtgccaattgccagcactgtcacacccgtatttatgaaaatcagccggaaaccatgaaacctatggccgtgcgcatgcataccaacaactttaaaaaagatccggaaacgcgtaaaacgtgtgtggattgtcacaagggtgttgcccacccgtatccaaaaggc BBa_K844000_sequence 1 catcatcaccatcaccaccatcatcaccattaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z