BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1602000 1 RBS-xylB B0034-xylB 2015-08-27T11:00:00Z 2015-09-25T01:14:47Z GenBank <style type="text/css"> <!-- ul.aufz10 { type="circle"; padding: 10px; margin: 15px 0px 0px 25px; } .block-10vi { list-style-image: url(http://parts.igem.org/wiki/images/5/57/Bild5.png); font-family: Verdana,sans-serif; font-size: 12px; font-weight: normal; color: #000000; } --> </style> <partinfo>BBa_IA</partinfo> <html> <br> <br> <b>Itaconic acid</b> is an organic, dicarboxylic acid that is biotechnologically synthesized in Aspergillus terreus. It is derived from citric acid via 2 intermediates and a final decarboxylation. <br> To enable this pathway in Escherichia coli it is necessary to introduce 3 genes. 2 of which are already established in the citric acid cycle and one that is from Apergillus terreus, a cis-aconitate decarboxylase (cadA). <img style="width: 900px; height: 99,4px; margin-left: 15px; margin-right: 15px;" alt="" src="pictures/operon_ia.001.jpg"> <p style="width: 900px; height: 99,4px; margin-left: 15px; margin-right: 15px;" alt="" > <br> <b>Figure 1</b> Reaction scheme of the itaconic acid producing operon. The substrates for the reaction are acetyl-coa and oxaloacetate. To simplify the process we are only looking at oxaloacetate right now. Oxaloacetate is metabolized to itaconic acid in 3 steps. </p> <br> <br> ===Usage=== <div align="right"> <table class="MsoTableGrid" style="border: medium none ; border-collapse: collapse; text-align: left; margin-left: auto; margin-right: auto;" border="0" cellpadding="0" cellspacing="0"> <tbody> <tr style="height: 214.9pt;"> <td style="padding: 0cm 5.4pt; width: 336.7pt; height: 214.9pt;"> This part is a composite of three genes, each with a strong RBS (<a href="/Part:BBa_B0034">BBa_B0034</a>) and all of them under control of one T7 Promoter (<a href="/Part:BBa_K1497017">BBa_K1497017</a>). <br> <br> <ul class="aufz10"> <li class="block-10vi">citrate synthase - gltA <a href="/Part:BBa_K1033001">(BBa_K1033001)</a></li> <li class="block-10vi">aconitate hydratase 1 - acnA <a href="/Part:BBa_K1033000">(BBa_K1033000)</a></li> <li class="block-10vi">cis-aconitate decarboxylase - cadA <a href="/Part:BBa_K1497000">(BBa_K1497100)</a></li> </ul> </td> <td> <font color="#FFFFFF">iGEM TU Darmstadt 2014 :)</font><br> </td> <td style="padding: 0cm 5.4pt; vertical-align: top; width: 236.7pt; height: 214.9pt;"> <img style="width: 400px; height: 120px;" alt="" src="pictures/all.png"> </p> <p class="MsoCaption" align="text-align:justify"> <b>Figure 2</b> Genetic map of the itaconic acid producing operon with T7 promoter. This brick directs the flux towards and finally enables <i>E.Coli</i> BL21 cells to synthesize itaconic acid in presence of the inductor IPTG. <br> </p> </td> </tr> </tbody> </table> </div> false false _2019_ 12512 25989 9 Not in stock false BLANK false Jonas Sindlinger, Leon Kraus, Jonathan Pletzer-Zelgert, Elena Tonchevska, Sebastian Holzner, Mirjam Haun, Sebastian Barthel component2463049 1 BBa_B0034 component2463050 1 BBa_K1602009 annotation2463049 1 BBa_B0034 range2463049 1 1 12 annotation2463050 1 BBa_K1602009 range2463050 1 19 765 BBa_K1602009 1 BBa_K1602009 xylB 2015-09-10T11:00:00Z 2015-09-25T01:22:39Z BLANK BLANK false false _2019_ 12512 25989 9 false BLANK false Leon Kraus, Jonathan Pletzer-Zelgert, Jonas Sindlinger, Carmen Sakas Gandullo, Sebastian Holzner, Elena Tonchevska, Mirjam Haun BBa_K1602000_sequence 1 aaagaggagaaatactagatgagcagcgccatttatccgagcctgaaaggtaaacgtgttgttattacaggtggtggtagcggtattggtgcaggtctgaccgcaggttttgcacgtcagggtgcagaagttatttttctggatattgcagatgaagatagccgtgcactggaagcagaactggcaggtagcccgattccgcctgtgtataaacgttgtgatctgatgaatctggaagccattaaagcagtgtttgccgaaattggtgatgttgatgttctggttaataacgcaggtaatgatgatcgtcataaactggcagatgttacaggtgcatattgggatgaacgcattaatgttaatctgcgccacatgctgttttgtacccaggcagttgcaccgggtatgaaaaaacgtggtggtggtgcagttattaactttggtagcattagctggcatctgggtttagaggatctggttctgtatgaaaccgcaaaagcaggtattgaaggtatgacccgtgccctggcacgtgaactgggtccggatgatattcgtgttacctgtgttgttccgggtaatgttaaaaccaaacgccaagagaaatggtatacaccggaaggtgaagcacagattgttgcagcacagtgtctgaaaggtcgtattgttccggaaaatgttgcagccctggtgctgtttctggcaagtgatgatgcaagcctgtgtacaggtcatgaatattggattgatgcaggttggcgttaa BBa_K1602009_sequence 1 atgagcagcgccatttatccgagcctgaaaggtaaacgtgttgttattacaggtggtggtagcggtattggtgcaggtctgaccgcaggttttgcacgtcagggtgcagaagttatttttctggatattgcagatgaagatagccgtgcactggaagcagaactggcaggtagcccgattccgcctgtgtataaacgttgtgatctgatgaatctggaagccattaaagcagtgtttgccgaaattggtgatgttgatgttctggttaataacgcaggtaatgatgatcgtcataaactggcagatgttacaggtgcatattgggatgaacgcattaatgttaatctgcgccacatgctgttttgtacccaggcagttgcaccgggtatgaaaaaacgtggtggtggtgcagttattaactttggtagcattagctggcatctgggtttagaggatctggttctgtatgaaaccgcaaaagcaggtattgaaggtatgacccgtgccctggcacgtgaactgggtccggatgatattcgtgttacctgtgttgttccgggtaatgttaaaaccaaacgccaagagaaatggtatacaccggaaggtgaagcacagattgttgcagcacagtgtctgaaaggtcgtattgttccggaaaatgttgcagccctggtgctgtttctggcaagtgatgatgcaagcctgtgtacaggtcatgaatattggattgatgcaggttggcgttaa BBa_B0034_sequence 1 aaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z