BBa_K1610300 1 BBa_K1610300 yebF (motor protein) 2015-09-05T11:00:00Z 2015-09-06T01:32:04Z This part was obtained from the NYMU iGEM Team. It is a sequence that is isolated from E. coli K12. YebF is an E. coli motor protein. When other proteins are fused to the yebF sequence, yebF can help secrete these proteins out of the E. coli membrane. false false _2027_ 22834 22834 9 false None. false Leon Yim BBa_K1610300_sequence 1 atgaaaaaaagaggggcgtttttagggctgttgttggtttctgcctgcgcatcagttttcgctgccaataatgaaaccagcaagtcggtcactttcccaaagtgtgaagatctggatgctgccggaattgccgcgagcgtaaaacgtgattatcaacaaaatcgcgtggcgcgttgggcagatgatcaaaaaattgtcggtcaggccgatcccgtggcttgggtcagtttgcaggacattcagggtaaagatgataaatggtcagtaccgctaaccgtgcgtggtaaaagtgccgatattcattaccaggtcagcgtggactgcaaagcgggaatggcggaatatcagcggcgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z