BBa_B0034 1 BBa_B0034 RBS (Elowitz 1999) -- defines RBS efficiency 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 RBS based on Elowitz repressilator. false true _1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix. <p>No secondary structures are formed in the given RBS region. Users should check for secondary structures induced in the RBS by upstream and downstream elements in the +50 to -50 region, as such structures will greatly affect the strength of the RBS. Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation23325 1 conserved range23325 1 5 8 BBa_K1610401 1 BBa_K1610401 pDAPa + RBS 2015-09-17T11:00:00Z 2015-09-18T06:10:08Z The source of this part comes from the iGEM parts registry. This part uses pDAPa promoter to control downstream gene expression. The pDAPa promoter is a repressible promoter that has no activity in the presence of dap acid. This part adds on an RBS to allow for easy cloning with downstream reporters. false false _2027_ 22834 22834 9 false None. false Leon Yim component2471282 1 BBa_B0034 component2471280 1 BBa_I718018 annotation2471280 1 BBa_I718018 range2471280 1 1 81 annotation2471282 1 BBa_B0034 range2471282 1 90 101 BBa_I718018 1 BBa_I718018 dapAp promoter 2007-10-25T11:00:00Z 2015-08-31T04:07:53Z none yet dapAp is the promter of dapA gene in E.coli. DapA enzyme is part of diaminopimelate (DAP)biosynthesis pathway. DAP is necessary for peptidoglycan and lysine biosynthesis. dapAp prmoter has been previously studied: Acord04: Acord J, Masters M (2004). "Expression from the Escherichia coli dapA promoter is regulated by intracellular levels of diaminopimelic acid." FEMS Microbiol Lett 235(1);131-7. PMID: 15158272 It has been shown that dapAp driven expression is inhibited at hight DAP. We have tried to confirm this by false false _141_ 0 1568 9 In stock false None false Eimad Shotar BBa_B0034_sequence 1 aaagaggagaaa BBa_I718018_sequence 1 aacaatcagaacggttctgtctgcttgcttttaatgccataccaaacgtaccattgagacacttgtttgcacagaggatgg BBa_K1610401_sequence 1 aacaatcagaacggttctgtctgcttgcttttaatgccataccaaacgtaccattgagacacttgtttgcacagaggatggtactagagaaagaggagaaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z