BBa_K1611000 1 BBa_K1611000 IFNgamma 2015-09-14T11:00:00Z 2015-12-17T01:03:34Z This sequence was synthesised by IDT based on the genomic murine IFN gamma. Murine IFN gamma cytokine codon optimized to give the best yield in yeast S. cerevisiae. It promotes T cell activation, upregulates MHC-I and is pro-inflammatory. false false _2028_ 4206 28291 9 false We performed a PCR site directed mutagenesis removing an enzyme restriction site in order to make it biobrick compatible. The mutation performed is silencious. false Frederic Ros annotation2456821 1 start range2456821 1 1 3 annotation2456819 1 c.198G>C range2456819 1 198 198 annotation2456820 1 stop range2456820 1 466 471 annotation2456822 1 cds range2456822 1 1 468 BBa_K1611000_sequence 1 atgaacgctacacactgcatcttggctttgcagctcttcctcatggctgtttctggctgttactgccacggcacagtcattgaaagcctagaaagtctgaataactattttaactcaagtggcatagatgtggaagaaaagagtctcttcttggatatctggaggaactggcaaaaggatggtgacatgaaaatcctccagagccagattatctctttctacctcagactctttgaagtcttgaaagacaatcaggccatcagcaacaacataagcgtcattgaatcacacctgattactaccttcttcagcaacagcaaggcgaaaaaggatgcattcatgagtattgccaagtttgaggtcaacaacccacaggtccagcgccaagcattcaatgagctcatccgagtggtccaccagctgttgccggaatccagcctcaggaagcggaaaaggagtcgctgctgataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z