BBa_K1611001 1 BBa_K1611001 MATalpha-IFNgamma 2015-09-14T11:00:00Z 2015-12-17T01:03:54Z MAT alpha was amplified from the S. cerevisiae genome. IFN gamma was synthesised by IDT based on the genomic murine IFN gamma. Both sequences have been assembled by golden gate to make a single fusion protein. Murine IFN gamma cytokine codon optimized to give the best yield in yeast S. cerevisiae. It promotes T cell activation, upregulates MHC-I and is pro-inflammatory. MAT alpha is the peptide leader used as a secretion signal and fused to IFN gamma without ATG. false false _2028_ 4206 28291 9 false We performed a PCR site directed mutagenesis removing an enzyme restriction site in order to make it biobrick compatible. The mutation performed is silencious. false Frederic Ros annotation2456823 1 start range2456823 1 1 3 annotation2456825 1 c.462G>C range2456825 1 462 462 annotation2456826 1 stop range2456826 1 730 735 annotation2456824 1 cds range2456824 1 1 732 BBa_K1611001_sequence 1 atgagatttccttcaatttttactgctgttttattcgcagcatcctccgcattagctgctccagtcaacactacaacagaagatgaaacggcacaaattccggctgaagctgtcatcggttactcagatttagaaggggatttcgatgttgctgttttgccattttccaacagcacaaataacgggttattgtttataaatactactattgccagcattgctgctaaagaagaaggggtatctctcgagaaaagagaggctgaagctaacgctacacactgcatcttggctttgcagctcttcctcatggctgtttctggctgttactgccacggcacagtcattgaaagcctagaaagtctgaataactattttaactcaagtggcatagatgtggaagaaaagagtctcttcttggatatctggaggaactggcaaaaggatggtgacatgaaaatcctccagagccagattatctctttctacctcagactctttgaagtcttgaaagacaatcaggccatcagcaacaacataagcgtcattgaatcacacctgattactaccttcttcagcaacagcaaggcgaaaaaggatgcattcatgagtattgccaagtttgaggtcaacaacccacaggtccagcgccaagcattcaatgagctcatccgagtggtccaccagctgttgccggaatccagcctcaggaagcggaaaaggagtcgctgctaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z