BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation1710 1 RBS range1710 1 7 10 annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1709 1 RBS-3\Weak range1709 1 1 13 BBa_K1613016 1 BBa_K1613016 It is a new part which can detect cadmium ions in liquid. 2015-09-05T11:00:00Z 2015-11-12T09:16:09Z The GFP will express when the sos response system has happened. This part is designed to proceed cadmium detection in e.coli.Zintp K896008 is a promoter which is designed by NYMU in 2013.It is a part highly specific to the cadmium.The promoter can trigger the RFP. We combine these part to detect cadmium. false false _2030_ 26843 26932 9 Not in stock false The sequence was retrieved from genebank. false CHANG I component2445040 1 BBa_K896008 component2445042 1 BBa_B0032 annotation2445042 1 BBa_B0032 range2445042 1 90 102 annotation2445040 1 BBa_K896008 range2445040 1 1 81 BBa_K896008 1 zinTp zinTp (Cd2+ sensing promoter) 2012-09-21T11:00:00Z 2015-07-24T01:12:28Z YES YES false false _1161_ 4206 9030 9 In stock false YES false Shih-Hao Chen annotation2202313 1 promoter range2202313 1 1 81 BBa_B0032_sequence 1 tcacacaggaaag BBa_K1613016_sequence 1 tgctctcgtttcctaagagttgttgcattttgctatatgttacaatataacattacacatcatatacattaactctggaggtactagagtcacacaggaaag BBa_K896008_sequence 1 tgctctcgtttcctaagagttgttgcattttgctatatgttacaatataacattacacatcatatacattaactctggagg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z