BBa_K1614001 1 BBa_K1614001 Hepatitis Delta Virus(HDV) Ribozyme 2015-09-13T11:00:00Z 2015-09-14T07:59:27Z Optimized sequence derived from hepatitis delta virus genome. The hepatitis delta virus ribozyme shows a specific and highly efficient cleavage activity at the RNAs 5' end of the sequence. Therefore it is highly suitable to create defined ends for functional RNA expression. false false _2031_ 12380 12380 9 false Cleavage occurs upstream of the G on the 5' end. false Stefan Holderbach BBa_K1614001_sequence 1 ggccggcatggtcccagcctcctcgctggcgccggctgggcaacattccgaggggaccgtcccctcggtaatggcgaatgggac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z