BBa_K1614004 1 BBa_K1614004 RFC 110 reverse linearization primer 2015-09-13T11:00:00Z 2015-09-20T01:05:04Z designed by iGEM Team Heidelberg 2015 Primer for the linearization of the RFC 110 standard assembly vector. false false _2031_ 24664 12380 9 false rough Tm: 72??C false Stefan Holderbach BBa_K1614004_sequence 1 ctatagtgagtcgtattagcgcgcgatatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z