BBa_K1614008 1 BBa_K1614008 His Tag AptaBody (A5) 2015-09-15T11:00:00Z 2015-09-16T02:53:41Z Synthetic His Tag AptaBody is a sequence consisting of a His-Tag aptamer and the HRP-mimicking DNAzyme for use in Western Blot applications. Between the His Tag aptamer and the HRP mimicking DNAzyme a 5x poly-A spacer is placed ensuring the functionality for ligand binding and peroxidase activity. false false _2031_ 24635 24635 9 false false Daniel Heid annotation2458387 1 HRP mimicking DNAzyme range2458387 1 47 62 annotation2458386 1 His-Tag Aptamer range2458386 1 1 40 BBa_K1614008_sequence 1 gctatgggtggtctggttgggattggccccgggagctggcaaaaagggtagggcgggttggg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z