BBa_K1614016 1 BBa_K1614016 Hammerhead Ribozyme and Malchite Green Aptamer in BBF RFC 110 transcription cassette 2015-09-15T11:00:00Z 2015-09-16T05:09:22Z Synthetic, Malchit Green aptamer (Grate, D., and Wilson, C. (1999). Laser-mediated, site-specific inactivation of RNA transcripts. Proceedings of the National Academy of Sciences of the United States of America 96, 6131-6136.) HHR (Prody, G.A., Bakos, J.T., Buzayan, J.M., Schneider, I.R., and Bruening, G. (1986). Autolytic processing of dimeric plant virus satellite RNA. Science 231, 1577-1580) Hammerhead Ribozyme (HHR) and Malchite Green (MG) Aptamer in BBF RFC 110 transcription cassette for live tracking of <i>in vitro</i> transcription. false false _2031_ 24664 24664 9 false Cloned without restriction enzymes to avoid issues occurring from conserved cut sites. For more details see BBF RFC 110. false Frieda Anna Sorgenfrei annotation2459466 1 T7 promotor range2459466 1 13 29 annotation2459490 1 Malachite Green Aptamer range2459490 1 85 122 annotation2459467 1 G required for transcription range2459467 1 30 30 annotation2459506 1 HDV range2459506 1 123 206 annotation2459489 1 HHR range2459489 1 31 84 BBa_K1614016_sequence 1 gatatcgcgcgctaatacgactcactatagtccagtcaccggatgtgctttccggtctgatgagtccgtgaggacgaaactggtggatcccgactggcgagagccaggtaacgaatggatccggccggcatggtcccagcctcctcgctggcgccggctgggcaacattccgaggggaccgtcccctcggtaatggcgaatgggacgatatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z