BBa_K1616006 1 End-rev Endolysin reversed 2015-09-16T11:00:00Z 2015-09-17T11:02:11Z This sequence is the reverse sequence of the holin/endolysin system. Holin and endolysin are toxins; after a period of late-gene expression, holin, an inner permeabilizing protein creates holes in the membrane in order to permeabilize it and then endolysin, a muralytic enzyme traverses the holes creating by holin and degraded the wall cell. This complex induce cell lysis of bacteria. (Young & Bl??si, 1995) <br><br> This part is the sequence reverse of the Holin/ Endolysin; thus this part can be used with a reverse promoter. Young, R., & Bl??si, U. (1995). Holins: Form and function in bacteriophage lysis. In FEMS Microbiology Reviews (Vol. 17, pp. 191???205). http://doi.org/10.1016/01686445(94)00079-4 false false _2033_ 22805 22805 9 false The illegal sites have been checked false Johanna Chesnel annotation2466126 1 Endolysin range2466126 1 1 514 BBa_K1616006_sequence 1 gctttatagatttttatacgcgtcccaagtgccagttctaaacgttgtaatgactcgttttgcgcgattaggtgtttgattataccatctacttttagctaagttaactgctgcttcatcccagcgtttttgttgaagcatacgtaaagagttagtaaatcctgccacaccggtttctcccatttggaaaaccatattaatcaatgcacagcgacgaaccgcatcaagagaatcataaaccggttttaatttagcatttctcaggattccgcgaacagcagcatcaacatcctgattaaagagtttttcagcctcatcttttgtaattacaccattgcaattacgcccaatagctttatctaattcagatttagcagcattaagtgatggactttttgtaagcaaatgaccgatgccaatagtgtaatagccttctgtgtctttatagattttaagtctaagaccttcatctatacgtaacatttcaaatatattcataatacctcctaagtat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z