BBa_K1616010 1 BBa_K1616010 Double terminator T7 2015-09-16T11:00:00Z 2015-09-17T09:08:31Z This part is the reverse sequence of the BBa_B0015 double terminator T7. For more efficiency of construction, scientists use more and more reverse promoter and then reverse sequence protein coding. This part have been created in order to stop transcription when we have a reverse sequence. So, this part is the reverse sequence of the BBa_B0015 double terminator T7. true false _2033_ 22805 22805 9 false We have checked that any illegal sites have been created. false Johanna Chesnel BBa_K1616010_sequence 1 tataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z