BBa_B0025 1 BBa_B0025 double terminator (B0015), reversed 2003-12-02T12:00:00Z 2015-08-31T04:07:20Z -- No description -- false true _1_ 0 24 7 In stock false true Caitlin Conboy annotation369703 1 B0010 range369703 1 50 129 annotation369702 1 B0012 range369702 1 1 41 BBa_K1616011 1 RBS-rev RBS reversed 2015-09-16T11:00:00Z 2015-09-17T10:56:58Z This part is the reverse sequence of the BBa_I712074 promoter T7. For more efficiency of construction, scientists use more and more reversed promoter and then reversed sequences of proteins coding. This part have been created in order to recruit transcriptional machinery and lead to transcritpion of the upstream DNA sequence. So, this part is the reverse sequence of the BBa_I712074 promoter T7. false false _2033_ 22805 22805 9 false We have checked that any illegal sites was formed. false Johanna Chesnel annotation2466086 1 RBS Reversed range2466086 1 1 14 BBa_K1616012 1 ccdB-rev ccdB reversed 2015-09-17T11:00:00Z 2015-09-18T02:43:04Z This part is the reversed sequence of the ccdB part: BBa_P1016. ccdB comes from the ccd system in Escherichia coli F plasmid and acts as a gyrase poison. false false _2033_ 22805 22805 9 false Illegal sites have been checked. false Johanna Chesnel annotation2469987 1 ccdB reversed range2469987 1 1 416 BBa_K1616013 1 BBa_K1616013 ccdB reversed - RBS and double T7 terminator 2015-09-17T11:00:00Z 2015-09-18T02:42:30Z This part is composed of ccdB reversed, RBS reversed and the double terminator T7 reversed. ccdB comes from the ccd system in Escherichia coli F plasmid and acts as a gyrase poison. The CcdB protein, constitutively expressed by P1010, is lethal to most of the BioBrick cell strains, onlyDB3.1 is resistant. false false _2033_ 22805 22805 9 false Illegal sites have been checked. false Johanna Chesnel component2470002 1 BBa_B0025 component2470004 1 BBa_K1616012 component2470006 1 BBa_K1616011 annotation2470002 1 BBa_B0025 range2470002 1 1 129 annotation2470006 1 BBa_K1616011 range2470006 1 562 575 annotation2470004 1 BBa_K1616012 range2470004 1 138 553 BBa_K1616011_sequence 1 ttgtcccctctttc BBa_K1616013_sequence 1 tataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctggtactagagttattatattccccagaacatcaggttaatggcgtttttgatgtcattttcgcggtggctgagatcagccacttcttccccgataacggagaccggcacactggccatatcggtggtcatcatgcgccagctttcatccccgatatgcaccaccgggtaaagttcacgggagactttatctgacagcagacgtgcactggccagggggatcaccatccgtcgcccgggcgtgtcaataatatcactctgtacatccacaaacagacgataacggctctctcttttataggtgtaaaccttaaactgcatagcatacctctttttgacatacttcgggtatacatatcagtatatattcttataccgcaaaaatcagcgcgcaaatacgcatactgttatctggcttttagtaagcctactagagttgtcccctctttc BBa_K1616012_sequence 1 ttattatattccccagaacatcaggttaatggcgtttttgatgtcattttcgcggtggctgagatcagccacttcttccccgataacggagaccggcacactggccatatcggtggtcatcatgcgccagctttcatccccgatatgcaccaccgggtaaagttcacgggagactttatctgacagcagacgtgcactggccagggggatcaccatccgtcgcccgggcgtgtcaataatatcactctgtacatccacaaacagacgataacggctctctcttttataggtgtaaaccttaaactgcatagcatacctctttttgacatacttcgggtatacatatcagtatatattcttataccgcaaaaatcagcgcgcaaatacgcatactgttatctggcttttagtaagcc BBa_B0025_sequence 1 tataaacgcagaaaggcccacccgaaggtgagccagtgtgactctagtagagagcgttcaccgacaaacaacagataaaacgaaaggcccagtctttcgactgagcctttcgttttatttgatgcctgg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z