BBa_K1616015 1 Linker-FOS Linker FOS of 17 aa 2015-09-17T11:00:00Z 2015-09-18T03:09:19Z Linker used in association with VVD (BBa_K1616014) This part is a sequence coding for 17 aa useful to link two proteins false false _2033_ 22805 22805 9 false Illegal sites have been checked false Johanna Chesnel annotation2470111 1 linker range2470111 1 1 51 BBa_K1616015_sequence 1 cgtccggcgtgcaaaatcccgaacgacctgaaacagaaagtcatgaaccac igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z