BBa_K1616016 1 YFP-C YC155 - C terminal YFP split 2015-09-17T11:00:00Z 2016-01-21T02:25:51Z This part works with BBa_K16160017. A split protein is a protein whose sequence has been divided into two (or more) different parts. Often used to study protein-protein interactions, the protein can not perform its function until the parts are put back together. For instance, YFP, the yellow-fluorescent protein, will only express fluorescence when its two parts will be reunited. In normal condition, the production of a protein in response to a stimulus can easily reach several hours due to the many steps required for the protein synthesis. By using split-proteins, we are taking advantage of the absence of fluorescence when the two parts are apart. Indeed, the two parts of our split-YFP, when remaining separated, can be produced without being effective. Therefore, the overall process is far less time-consuming. However, to implement a light control on the fluorescence activation, a genetic construction gathering the VVD photoreceptor and our split-YFP has to be engineered. The new alternative approach for the visualization of protein interactiosn has been developed; the biomolecular fluorescence complementation (BiFC) techniques based on the complementation between fragments of fluorescent proteins; fragments of the yellow fluorescent protein (YFP) brought together by the association of two interaction partners fused to the fragments. They noticed that the spectral characteristics of BiFC of YFP were virtually identical to those of intact YFP.(Chang-Deng Hu, 2003) false false _2033_ 4206 22805 9 false Illegal sites have been checked. false Johanna Chesnel annotation2470135 1 YC155 range2470135 1 1 255 BBa_K1616016_sequence 1 gacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z