BBa_K1620001 1 Zasp Promoter element Zasp 2015-09-02T11:00:00Z 2015-09-13T03:25:58Z The promoter element was designed through bioinformatic analysis of 500bp frame upstream genes of operon ZnuABC from E. coli K12 MG16555 genome. Then, it was synthesized by IDT through G-block and further assembled by 3A assembly method. It is a zinc activity sensing promoter element. The regulation of this promoter is Zur dependant and positive in absent of zinc or other divalent metallic cations in medium. The Zur protein binds those cations repressing the expression of the gene downstream Zasp element. In our project, it was used to trigger the expression of killer genes downstream this element. Since ZnuABC activity is extremelly sensitive to low zinc concentrations, we believe that this component will be usefull for other teams in order to its inducible feature and precise functioning. false false _2037_ 23597 23597 9 false We have identified two sequences of this promoter (one in sense strand and another in the antisense strand). In order to turn this sequence more feasible we used a hybrid final sequence. The final sequence was believed to promote for both sites. false Celio Dias Santos Jr annotation2453426 1 Promoter Zasp range2453426 1 1 50 BBa_K1620001_sequence 1 taagcgttttacatccgatgggcgcagtgaataatcatgttctgaagcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z