BBa_K1620002 1 BBa_K1620002 small heat shock protein IbpA 2015-09-02T11:00:00Z 2015-09-13T03:51:31Z This part was designed from gene IbpA of E. coli K12 MG16555 genome, and synthesized by IDT. PCR amplifications were carried out using primers showed bellow and the 3A assembly method was made. PCR primers: Fwd: 5' - GAA TTC GCG GCC GCT TCT AGA GAT GCG TAA CTT TGA TTT ATC - 3' Rev: 5' - TAC TAG TAG CGG CCG CTG CAG TTA GTT GAT TTC GAT ACG GC - 3' The IbpA is a small heat shock protein. It is expressed under stress conditions which associates with aggregated proteins. Together with IbpB, to stabilize and protect them from irreversible denaturation and extensive proteolysis during heat shock and oxidative stress. Aggregated proteins bound to the IbpAB complex are more efficiently refolded and reactivated by the ATP-dependent chaperone systems ClpB and DnaK/DnaJ/GrpE. Its activity is ATP-independent. It is extensively documented in the following link: <http://www.uniprot.org/uniprot/P0C054>. In our project, we have figured out to construct a protein solubilization device for high rate expressed proteins. false false _2037_ 23597 23597 9 false This part was made using original codon frequencies of E. coli. false Celio Dias Santos Jr annotation2443226 1 Fwd_IbpA range2443226 1 1 22 annotation2443227 1 Rev_IbpA range2443227 1 394 414 annotation2443225 1 IbpA range2443225 1 1 414 BBa_K1620002_sequence 1 atgcgtaactttgatttatccccgctttaccgttctgctattggatttgaccgtttgtttaaccacttagaaaacaaccagagccagagtaatggcggctaccctccgtataacgttgaactggtagacgaaaaccattaccgcattgctatcgctgtggctggttttgctgagagcgaactggaaattaccgcccaggataatctgctggtggtgaaaggtgctcacgccgacgaacaaaaagagcgcacctatctgtaccagggcatcgctgaacgcaactttgaacgcaaattccagttagctgagaacattcatgttcgtggtgctaacctggtaaatggtttgctgtatatcgatctcgaacgcgtgattccggaagcgaaaaaaccgcgccgtatcgaaatcaactaa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z