BBa_K1620004 1 Zur Zinc uptake regulation protein - Zur 2015-09-02T11:00:00Z 2015-09-13T03:57:27Z Designed from gene "zur" from E. coli K12 MG-1655 genome. Synthesized as G-block by IDT. PCR amplified using following primers: Fwd: 5' - GAA TTC GCG GCC GCT TCT AGA GAT GGA AAA GAC CAC AAC GCA - 3' Rev: 5' - TAC TAG TAG CGG CCG CTG CAG TTA ACG CGG TTT CTT TTT CA - 3' The assembly was made through 3A assembly method. Acts like a negative controlling element of promoter Zasp (BBa_K1620001) by use of Zn(II) as a cofactor to bind the operator of the repressed genes (znuACB). In our project it was used to regulate a kill switch based on zinc concentration to promote cellular death. false false _2037_ 23597 23597 9 false The designed gene was as provided by E. coli genome, with the same codon frequencies. false Celio Dias Santos Jr annotation2443232 1 Fwd range2443232 1 1 20 annotation2443231 1 Zur range2443231 1 1 519 annotation2443233 1 Rev range2443233 1 499 519 BBa_K1620004_sequence 1 atggaaaagaccacaacgcaggagttattagcgcaggctgaaaaaatctgcgcgcagcgtaatgtgcgcctgaccccacagcgcctggaagtgttgcgcctgatgagtctgcaagatggcgctatcagcgcttatgatctgcttgatttactgcgcgaagctgaaccgcaagccaagccgccaacggtttatcgcgcgctggattttctgcttgagcaaggttttgtgcataaggtggaatccaccaacagttatgtgctctgtcatctgttcgatcagcccacccatacgtcagccatgtttatttgcgatcgctgcggcgcagtgaaagaagagtgtgcagaaggcgtggaagacattatgcatacgctggcggcaaaaatggggtttgccctgcggcataatgtgattgaagcacatgggctctgtgcggcatgtgtagaagtggaagcgtgtcgtcatcctgaacagtgccagcatgatcactctgtgcaggtgaaaaagaaaccgcgttaataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z