BBa_K1621001 1 BBa_K1621001 Glycoprotein E epitope derived from Varicella Zoster Virus 2015-08-28T11:00:00Z 2015-08-30T11:00:14Z The sequence was synthesized by IDT according to B??ckstr??m et al. (2011) An infection going along with red and itching skin that nearly every person in the world suffers from???most might know it as chickenpox and might not even remember the first infection as this often takes place during childhood. The infection is caused by a virus that belongs to the family of Herpesviridae, the same family as the Herpes Simplex Virus, and contains double-stranded DNA. It is transmitted via droplet infection or by having contact with blisters or mucous membranes. Following the first contact with the virus and with an incubation time of about two weeks the patient suffers from fever and exanthemas that normally heal without leaving scars. This first infection is called Varicella Zoster or, as mentioned above, chicken pox. All over the world it is thought that >95% of adults have antibodies against the Varicella Zoster Virus in their blood. As the virus resides in some ganglions of the body, mostly elderly or immune deficient people might again be afflicted with the disease that is then called Herpes Zoster. It manifests itself in exanthemas restricted to the area of the respective ganglion that is affected. Additionally, the patients are very sensitive to skin contact, have a fever and feel pain. In some cases the reactivation of the virus can lead to neuritis. Normally the infection with the virus, the primary infection as well as the reactivation of the virus, are not life threatening and in most cases end without consequences for the patient. The primary infection is only a threat for newborns and immune deficient patients where a hemorrhagic development can be lethal. If adults are for the first time exposed to the virus it can also cause much more severe damage. The development of nervous defects is as well possible as pneumonia. The For our DiaCHIP we expressed the glycoprotein E of the virus. It forms heterodimers with the glycoprotein I and was found to play an important role in cell-cell attachment as well as facilitating the entry of the virus and the assembly of the virion (Mo et al.: Glycoprotein E of Varicella-Zoster Virus Enhances Cell-Cell Contact in Polarized Epithelial Cells). false false _2038_ 25598 24643 9 false The sequence was codon optimized using the Codon Optimization Tool from IDT false Julika Neumann, Ramona Emig, Rabea Jesser, Lara Stuehn annotation2439943 1 Glycoprotein E range2439943 1 4 1551 BBa_K1621001_sequence 1 atgacgaatcccgtcagagcgtctgtgctgagatatgacgattttcacaccgatgaagataaactcgacaccaatagcgtgtacgaaccatactaccacagcgatcatgcggaaagctcttgggtgaataggggtgagtcctccagaaaggcttacgaccataattcaccttacatttggcccaggaacgactacgacggctttctcgagaatgcccacgagcaccacggcgtgtacaaccagggtcgggggatcgactcaggggagcggctgatgcagcccacacagatgtctgctcaggaggacctgggcgatgataccggcatccacgtgattccgactctgaacggggatgaccgccacaagatcgtaaatgtcgaccaaaggcagtatggagacgtattcaaaggggaccttaaccctaaacctcagggccagcgcctgatagaggtctccgtggaggaaaaccacccttttacccttagagctcccattcagagaatttacggagtgcgctacaccgaaacatggagcttcctccccagtctcacttgcaccggcgacgccgcgccagccatccagcacatttgtctgaaacacaccacctgtttccaggacgttgttgtggacgtagattgtgctgagaacacaaaggaggatcagttggctgaaatctcctatcgctttcagggcaagaaggaggccgaccagccttggattgtggtaaacacctccacgctgtttgatgagcttgagctcgaccctcctgagatcgagcctggtgtactgaaagtgctccgcacagaaaagcagtatttgggggtgtacatctggaacatgaggggcagtgatggcacttccacctatgccactttcctggtcacctggaaaggcgacgagaagaccaggaaccccacaccagcggtcacacctcaaccaagaggggccgagtttcacatgtggaattaccactcccacgtgttcagtgtcggtgacacattctccctggctatgcatctgcaatacaaaatccatgaggcgccttttgatctgctcctcgaatggctctacgtgcccattgaccccacttgtcagccaatgaggctctattccacctgcttgtaccacccaaacgcaccccagtgtcttagccatatgaactctggatgtacattcacgagtccgcatcttgcccaacgcgttgcatctaccgtgtaccagaactgtgagcatgccgataactacaccgcgtattgcctgggcatcagccacatggagcccagtttcggactgatacttcacgacggcggaacaacactgaagttcgtggacacaccagagagtctctctggcctgtacgtgttcgtggtgtattttaacggacatgtggaggccgtggcttacacagtggtcagcaccgtggaccattttgtgaatgccatcgaggaacgggggttcccacccaccgcagggcagcctcctgcaacaacaaagcccaaggaaatcacccccgttaatcccgggacatctcccttgttgcgatatgccgcc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z