BBa_K1621002 1 BBa_K1621002 Glycoprotein G1 (Herpes simplex type1) 2015-08-27T11:00:00Z 2015-08-28T06:59:35Z The sequence was obtained from J????skel??inen et. al (2009) and synthesized from Integrated DNA Technologies A lot of people might have already had little blisters in the area of the lip that disappeared after some days. In most cases those might have been provoked by the Herpes Simplex Virus Type 1 (HSV1). HSV1 belongs to the Human Herpesviruses and is therefore part of the family of Herpesviridae. It consists of double-stranded DNA and an envelope containing at least 10 viral proteins surrounds the capsid. Most of these proteins are glycoproteins, one of which is the glycoprotein G that we express. It is the glycoprotein differing the most among the different species so it allows their discrimination. Glycoprotein G is important for the attachment to the cell and the entry into it. There are two different types of Herpes Simplex Virus with about 99% of identity in the gene regions. Both types are transmitted via the contact of mucous membranes. Type 1 ??? the one we are working with ??? can be transmitted via kissing, type 2 is mainly transmitted via sexual contact. Below we are only referring to the Herpes Simplex Virus Type 1. It remains in the body in a latent state and several outbreaks during life are possible. As about 85-90% of the world???s population is seropositive the primary infection often takes place prior to the age of five due to a transmission from the parents to their child. The infection of newborns is dangerous to life. After infection the virus proliferates and is shed via the mucous membrane. It also infiltrates neurons in which it persists life-long. In very severe cases the virus can cause encephalitis as well all meningitis. The reasons for sudden outbreaks of the virus are not clearly understood. A suppression of the immune system or stress are only some possible explanations. A therapy with anti-viral drugs is possible, for cutaneous infections in facial or rather labial areas the application of corticoids is however usually sufficient. false false _2038_ 25600 25600 9 false The sequence was codon optimized for expression in E.coli with codon optimization tool from IDT false Lara Stuehn, Ramona Emig, Julika Neumann, Rabea Jesser annotation2439295 1 Glycoprotein G (epitopes) range2439295 1 4 393 BBa_K1621002_sequence 1 atgaccactggtcggccttctcatgaagcaccgaatatgacccaaactggcaccacagacagcccgaccgcaattagcttgaccacacccgaccacacgccaccgatgccgagcattggtttaatggaggaagaagaggaagaggaaggcgctggcgatggtgaacatctggaagggggagacggtacacgcgacaccctgccgcagagcccgggccctgcgtttccgctggccgaagacgtagagaaagataaacctaaccgcccggttgttccgtctcccgatcctaataattcccctgctcgtccagaaacctcgcgccccaagaccccgccaacaattatcggtccgctggccacgcgtccaaccacccgtttaacaagcaaaggtcgccca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z