BBa_K1621003 1 BBa_K1621003 TeNT_Hc - C-terminal part of the heavy chain (tetanus toxin) 2015-08-27T11:00:00Z 2015-08-30T12:26:34Z The sequence for this part was obtained from Yu et. al (2010) and synthesized by Integrated DNA Technolgies. If the ambulance is called to take care of an injured person often the first thing they do is to perform a preventing vaccination against Clostridium tetani. This is a little anaerobic gram-positive rod-shaped bacillus that forms spores. These can even survive in inhospitable areas and are present in soil. They can enter the human body easily via small wounds which is why injured people are at high risk of getting infected with C. tetani but cannot transmit the infection to other individuals. In regions where people are not vaccinated and good health care is not provided, tetanus, which is caused by the bacterium, is a very common cause of death following injuries. The bacterium produces two toxins, named tetanospasmin and tetanolysin. The former was found to cause tetanus by reaching the bone marrow via the nerves. There it is responsible for provoking hypersensitivity, increased reflexes and spasms. The latter causes damage to the heart muscle and blood components. After an infection with C. tetani the first symptoms are headache, muscle and dorsal pain and a feeling of being tired. Additionally, the patient may feel some tautness in the area of the injury and reveal sensitivity to light and noise. If the patient is not taken care of, the infection is manifested by local stiffening of muscles, mainly those in the area of the jaw and neck. In the following progression the patient will suffer from high fever and muscle spasms. Those will at first be located in the face but spread over the whole body what causes the typical extended position. The immense tension in the muscles due to the effect of the toxins can cause lesions as well as dislocations of the joints or broken bones. As a consequence, many patients suffer from shortened muscles, ankylosis (stiffness of the joints) or spine deformity. In case of the lack of appropriate health care, death due to suffocation or cardiovascular failure is common and occurs partially despite previous vaccination. To avoid long-term effects due to an infection with C. tetani or even death, the wound is excised and surgically taken care of. Additionally, the patient will be treated with antibiotics and will be given antibodies targeting the toxin. For our DiaCHIP we expressed a part of the tetanospasmin protein that is generally referred to as tetanustoxin. It consists of a heavy and a light chain that are linked by disulfide bonds. We worked with the carboxyl-terminal domain of the heavy chain that is able to bind to the target membrane and allows the internalization of the actual toxic region of the light chain. As we did not express any of the toxic fragments there was no need for special safety measures. The toxin fragment interfering with the neuronal system was not expressed and the part we used is not able to reproduce itself. false false _2038_ 25598 25600 9 false The sequence was codon optimized for expression in E.coli with the codon optimization tool from IDT. false Lara Stuehn, Ramona Emig, Julika Neumann, Rabea Jesser annotation2439313 1 Clostridium tetani TeNT_Hc range2439313 1 4 1353 BBa_K1621003_sequence 1 aaaaatttagattgctgggtggataatgaggaagatattgatgtcattctgaaaaaaagcactattttgaatctggatatcaacaacgatatcatctccgatatctctggcttcaattcctcggtaatcacatatccggacgcacagctggttccgggcatcaacggtaaggccattcacttggtgaacaacgagtcgagcgaggttattgtccacaaagctatggatatcgaatataacgatatgtttaataactttacggtgagcttctggctgcgcgtgccaaaagtaagtgcatcccatttagaacagtacgacaccaacgaatacagtattatttccagtatgaagaaatattcgctttcgatcggctcaggatggagtgtaagtcttaaaggcaacaatcttatttggacgttgaaagatagcgccggcgaagtgcgccagattacatttcgcgacttgagtgataaatttaacgcatacctggcaaacaagtgggtattcattactattaccaatgatcgcctgagtagtgccaacctgtacatcaacggcgtattgatgggttccgcagaaattaccggcttgggtgccatccgtgaagataacaatatcactttgaaactcgaccgctgcaacaataataaccaatatgtatcgatcgataaattccggatcttttgtaaagctcttaacccgaaagagattgagaaactctacacgtcatatttgtccattaccttcctgcgtgatttctggggcaatccgctgcggtacgacaccgaatactaccttattcctgtcgcctatagtagtaaagatgtccagttaaaaaacattacagattatatgtaccttaccaacgcgccttcgtacaccaacgggaagctgaacatttattaccgccgtctgtacagcggtctgaaatttatcattaaacggtatacgcctaacaatgagattgactccttcgtccggtcgggggactttatcaaattgtatgtttcatataataacaacgaacacattgtcggctacccaaaagatggaaacgcgtttaataacctcgaccgcattctgcgtgtcggctacaacgcgccaggaatcccgttatacaagaaaatggaagccgtcaaactccgcgatcttaaaacttattcagtgcagcttaaactctacgatgacaaagatgcttcactgggtttagtcggaactcataacggccagatcggcaacgatccaaaccgcgacatcttaatcgcgtcgaactggtattttaaccacctgaaagataaaaccctgacctgtgattggtatttcgtccctaccgatgaaggctggaccaatgat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z