BBa_K1621004 1 BBa_K1621004 gag/tat/pol/env - polyepitopic antigen derived from HIV-1 2015-08-27T11:00:00Z 2015-09-15T05:46:27Z The sequence for this part was obtained from Rahimi et al. (2015) and synthesized by Integrated DNA Technologies. There are many epitopes known from the Human Immunodeficiency Virus 1, comprising envelope proteins as well as glycoproteins amongst others. For our purposes we found a paper introducing a multi-epitopic recombinant protein that is constructed with six different epitopes. The single epitopes are two of the HIV-1-trans-activating (tat) encoding region, one epitope of the reverse transcriptase, one of the p24 protein, one of the envelope protein gp41 and one of gp120. The HI Virus itself is highly immunogenic and underlies strict safety regulations. The great advantage of the multi-epitopic protein is that it does not have any immunogenic properties and is only built with small parts of functional proteins but still combines some of the most important epitopes present on the virus. false false _2038_ 24643 25600 9 false The sequence was codon optimized for expression in E.coli with the codon optimization tool from IDT. false Lara Stuehn, Ramona Emig, Julika Neumann, Rabea Jesser annotation2439314 1 HIV gag/tat/pol/env epitopes range2439314 1 4 543 BBa_K1621004_sequence 1 atggggattagctatggccgcaagaaacgtcgccaacgtcgtcgtgcgcatcagaacatggaaccagtagacccgcgtctggagccgtggaaacatccgggctctcagccgaaaaccgcagcgtatccgcaaggatggaaaggaagcccggcgattttccagtctagcatgaccaaaatcctggagccattccggaaacaaaacccggacattgtcatttatcaatacatggatgatttgtacatggtgggtgcggcagcgaaggagccgttccgtgattacgtagatcgtttttataaaacccttcgggctgaacaagcaagccaggaagttaagaactggatgacggcggcctatcaggctcgcattttggcggtagaacgttacctgaaagaccaacagctgctgggcatttggggctgttcaggaaagctgatctgcacgactgcggtgccgtggtgtacgcgtccgaacaacaacacccgcaaacgtatccgtattcaacggggtcctggtcgcgcgttcgtaaccattggaaagatc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z