BBa_K1621005 1 BBa_K1621005 TpF1 - bacterioferritin derived from Treponema pallidum 2015-08-28T11:00:00Z 2015-08-31T01:30:30Z The part's sequence was obtained from Jiang ''et al.'' (2013) and synthesized by Integrated DNA Technologies. This part contains the coding sequence of a bacterioferritin monomer derived from ''Treponema pallidum'', TpF1. It was isolated from the subspecies ''pallidum'' which causes syphilis, a disease that is transmittable by sexual contact or congenitally. Worldwide, more than 12 million new cases of syphilis are reported which underlines the need of high detection methods that are highly sensitive and specific as well as easy to perform. TpF1 was shown to be highly immunogenic in humans and rabbits (McGill ''et al.'', 2010), what was the reason for Jiang ''et al.'' (2013) to use it for the establishment of a diagnostic ELISA for clinical applications. Bacterioferritins in general are central players in bacterial iron metabolism. Their functions reach from detoxification of iron in the cell to iron storage and even protection against oxidative stress (Carrondo, 2003). Disuflide bonds and hydrophobic interactions mediate the formation of homo-24-mers of about 190 kDa in the outer membrane (Radolf ''et al.'' 1987). Treatment with β-mercaptoethanol or boiling in SDS leads to dissaggregation of the complex, resulting in smaller oligomers (~160 kDa) and monomers (~19 kDa). This part???s sequence encodes for such a monomer (Jiang ''et al.'' 2013). The sequence was synthesized by Integrated DNA Technologies in a variant that was codon optimized for expression in ''Escherichia coli'' with the respective tool from IDT. It was shipped to the registry in standard pSB1C3 and begins with a start codon (ATG). Cloning into the shipping backbone was performed by Gibson Assembly. false false _2038_ 25598 25598 9 false Before synthesis the sequence was codon optimized for expression in ''E. coli'' with the codon optimization tool from IDT. false Ramona Emig, Rabea Jesser, Julika Neumann, Lara Stuehn annotation2440568 1 TpF1 range2440568 1 4 531 BBa_K1621005_sequence 1 atgaacatgtgcacggacggaaaaaaatatcacagcacggcgacgtctgcggccgtgggagcttctgcgccgggcgtaccggacgcccgggctatcgcggcaatctgtgaacagctgcgccagcatgttgctgacctgggtgtgctttatatcaaactccacaactaccactggcatatctacggaattgaatttaaacaggtgcatgaactgctggaagaatattatgtgagcgtgactgaagcctttgataccattgccgaacggctccttcaactcggggcgcaggcgccagccagcatggcggaatacttagcgctgtctggtattgcagaggaaacggagaaagagattacgatcgtttcggcgttagcgcgcgtgaagcgtgattttgaatatttaagcacacgtttttctcagactcaggtgctggccgcggaatcaggagacgccgtaacggacggtattattaccgatattctgcgcacattagggaaagcaatttggatgctgggcgcaaccttaaaagca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z