BBa_K1621006 1 BBa_K1621006 Dihydroxyacid dehydratase (Salmonella Typhimurium) 2015-08-27T11:00:00Z 2015-09-11T05:56:16Z The part is derived from Salmonella typhimurium. The sequence as well an expression plasmid carrying the part in a His-tagged variant were obtained from Meyer et al. (2012). This part contains the coding sequence of the enzyme dihydroxyacid dehydratase from //Salmonella typhimurium//. Its main biological function is the dehydratation of 2,3-dihydroxy-isovaleic acid into alpha-ketoisovaleric acid in the biosynthesis of isoleucine and valine. Additionally, the protein is immunogenic in humans as it was shown by the group of Prof. Dr. Michael Hust at TU Braunschweig (Meyer //et al.//, 2012). This is why the part can be used for diagnostic purposes concerning //S. typhimurium//. The sequence as well as an expression plasmid carrying its sequence in a His-tagged variant was obtained directly from this group. false false _2038_ 25598 25598 9 false Two recognition sites for PstI have been removed by site-directed mutagenesis. Therefore, the guanine residues at positions 96 and 679 have been mutated into cytosines. This results in one silent mutation and an amino acid exchange from alanine to proline at position 227 of the primary structure. false Ramona Emig, Rabea Jesser, Julika Neumann, Lara Stuehn BBa_K1621006_sequence 1 atgcaggtcctggtggatgattgctatggtgaaagtcatccgggcagtttccatcttaaccaactgggcgatgaagccgtgctgggtgttcatgaaagcggcggtcgcgcggtccgtcaccatgtgacggatatctgcgacggctggggtcagggccacgatgggatgaactacatcctggcatctcgcgaagccattgccaacatggtcgaaattcatgcctcagtggtgccttatgatgccggtattctgatctcaagctgcgataaatctatcccggcgcatctgattgccgccgcacgcctgaacctgccgctactgcatattcccggcggttctatgcgtccggcaccgaatatgagtacttctgacctcggtgggatcactgctaagttgaagaaaggcgaaatcggcattcagcaagtggaagccatgcagcaatgcggttgccccaccgccggagcctgccagtttatgggaacggccagtaccatgcagtgcatgtcggaggccttggggctggccctgccaggcagcgctttgctgccatcgaccctggcggaaattcgccgcgttgccagaact igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z