BBa_K1624002 1 BBa_K1624002 LacO 2015-09-10T11:00:00Z 2015-09-16T07:11:53Z We used the lacO sequence from the Novagen pCDFDuet???-1 vector. Lac operator sequence, involved in transcriptional regulation of the lac operon. Can be placed between promoter and RBS sequence to regulate expression of gene by induction. false false _2041_ 24695 24695 9 false N/A false LASA iGEM 2015 annotation2449888 1 lacO range2449888 1 1 23 BBa_K1624002_sequence 1 ggaattgtgagcggataacaatt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z