BBa_K1624008 1 BBa_K1624008 pCoof->RBS 2015-09-15T11:00:00Z 2015-09-16T07:33:57Z BBa_K352002 (pCoof), BBa_K1624003 (RBS). From lab member, pCDF plasmid. pCoof promoter followed by ribosome binding site. May be placed in front of genes to regulate expression in response to CO presence. false false _2041_ 24695 24695 9 false PCR'd out T7 and lacO from pCDF plasmid, replacing with pCoof promoter, in front of RBS. false Andrew Ellington annotation2463034 1 pCoof range2463034 1 1 94 annotation2463036 1 RBS range2463036 1 104 110 annotation2463033 1 BBa_K352002 range2463033 1 1 94 annotation2463035 1 BBa_K1624003 range2463035 1 104 110 BBa_K1624008_sequence 1 ttcggcgtcttttcatacccccataaaaactctggataactgtcatctggccgacagacggggccgggctttttgtcgcttactcggcgccaggaactttaagaaggagatatacat igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z