BBa_K864100 1 SYFP2 Super Yellow Fluorescent Protein 2 (SYFP2) 2012-09-23T11:00:00Z 2016-01-21T02:29:24Z Amino acid sequence taken from the article by Kremers et al 2006. Released HQ 2013 This part codes for the bright yellow fluorescent protein SYFP2. SYFP2 is a GFP based monomeric protein with a narrow fluorescence emission spectrum with a maximum at 515 nm. Bacteria expressing SYFP2 are reported to be 12 times brighter than those expressing EYFP(Q69K) and almost 2-fold brighter than bacteria expressing Venus (Ref. 10.1021/bi0516273). Codon optimized for expression in E coli by DNA 2.0. Mutations compared to wtGFP amino acid sequence (GenBank Accession number M62653) are F46L F64L S65G S72A M153T V163A S175G T203Y A206K. false false _1124_ 4206 10137 9 In stock false The sequence has been codon optimized for expression in E coli by DNA 2.0. false Erik Gullberg annotation2196221 1 SYFP2 range2196221 1 1 717 BBa_J23110 1 BBa_J23110 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1627007 1 BBa_K1627007 Super Yellow Fluorescent Protein, with Medium Promoter and RBS 2015-09-09T11:00:00Z 2015-09-17T12:28:36Z This plasmid was constructed from previously constructed Biobrick parts. The pSB1C3 backbone, BBa_K314100 vector, and the BBa_K864100 Super Yellow Fluorescent Protein. This is a plasmid using the pSB1C3 backbone, which is composed of the CamR resistance gene and the pMB1 origin of replication. A vector was inserted into the plasmid backbone, BBa_K314100, which is composed of the Bio-Brick promoter BBa_J23100 and ribozome binding site BBa_B0034. A fluorescent protein gene was then inserted into the resulting plasmid. BBa_K864100, the Super Yellow Fluorescent Protein 2 gene was the fluorescent gene inserted in the plasmid. This plasmid allows the creation of the super yellow fluorescent protein inside bacteria. false false _2044_ 22564 27789 9 false The plasmid was constructed and cloned from parts from the Biobrick registry. false Devin Wehle component2460951 1 BBa_B0032 component2460954 1 BBa_K864100 component2460949 1 BBa_J23110 annotation2460954 1 BBa_K864100 range2460954 1 63 785 annotation2460949 1 BBa_J23110 range2460949 1 1 35 annotation2460951 1 BBa_B0032 range2460951 1 44 56 BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1709 1 RBS-3\Weak range1709 1 1 13 annotation1710 1 RBS range1710 1 7 10 BBa_K864100_sequence 1 atggttagcaagggcgaagaactttttacaggcgtagtaccgatcttagttgaattagacggcgacgttaacggtcataagtttagcgtgagcggtgagggtgaaggtgacgcaacttacggcaagctgaccctgaagctgatttgcacgacgggtaagctgccggtcccgtggcctaccctggtcacgaccttgggttatggcgttcagtgtttcgcgcgttatccggaccacatgaaacaacacgatttctttaagagcgcgatgccagaaggctatgtgcaggagcgtacgatctttttcaaagacgacggtaactacaagacgcgtgccgaagtcaaattcgaaggcgacaccctggtgaatcgcattgagctgaagggtattgatttcaaagaggatggcaatatcctgggtcacaagctggagtacaattacaattcccacaacgtttacatcaccgcagataaacagaaaaatggcatcaaagcgaatttcaaaatccgtcacaacattgaggacggtggtgttcaactggcggatcattaccagcaaaacaccccgattggtgacggtccggtcctgttgccggataaccattatctgtcttaccaaagcaaactgagcaaagatccgaacgagaagcgcgaccacatggtgctgctggagtttgtgaccgctgccggtattaccctgggtatggatgagctgtataaataataa BBa_B0032_sequence 1 tcacacaggaaag BBa_K1627007_sequence 1 tttacggctagctcagtcctaggtacaatgctagctactagagtcacacaggaaagtactagatggttagcaagggcgaagaactttttacaggcgtagtaccgatcttagttgaattagacggcgacgttaacggtcataagtttagcgtgagcggtgagggtgaaggtgacgcaacttacggcaagctgaccctgaagctgatttgcacgacgggtaagctgccggtcccgtggcctaccctggtcacgaccttgggttatggcgttcagtgtttcgcgcgttatccggaccacatgaaacaacacgatttctttaagagcgcgatgccagaaggctatgtgcaggagcgtacgatctttttcaaagacgacggtaactacaagacgcgtgccgaagtcaaattcgaaggcgacaccctggtgaatcgcattgagctgaagggtattgatttcaaagaggatggcaatatcctgggtcacaagctggagtacaattacaattcccacaacgtttacatcaccgcagataaacagaaaaatggcatcaaagcgaatttcaaaatccgtcacaacattgaggacggtggtgttcaactggcggatcattaccagcaaaacaccccgattggtgacggtccggtcctgttgccggataaccattatctgtcttaccaaagcaaactgagcaaagatccgaacgagaagcgcgaccacatggtgctgctggagtttgtgaccgctgccggtattaccctgggtatggatgagctgtataaataataa BBa_J23110_sequence 1 tttacggctagctcagtcctaggtacaatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z