BBa_J23110 1 BBa_J23110 constitutive promoter family member 2006-08-16T11:00:00Z 2015-08-31T04:08:40Z Later Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1627009 1 BBa_K1627009 Enhanced Yellow Fluorescent Protein, with Medium Promoter and RBS 2015-09-11T11:00:00Z 2015-09-17T12:29:13Z This plasmid was constructed from previously constructed Biobrick parts. The pSB1C3 backbone, BBa_K608006 vector, and the BBa_E0030 Enhanced Yellow Fluorescent Protein. This is a plasmid using the pSB1C3 backbone, which is composed of the CamR resistance gene and the pMB1 origin of replication. A vector was inserted into the plasmid backbone,BBa_K608006 (J23110 + B0032), which is composed of the Bio-Brick promoter BBa_J23110 and ribosome binding site BBa_B0032. A fluorescent protein gene was then inserted into the resulting plasmid. BBa_E0030, the Enhanced Yellow Fluorescent Protein gene was the fluorescent gene inserted in the plasmid. This plasmid allows the creation of the enhanced yellow fluorescent protein inside bacteria. This plasmid (BBa_K1627009) was used in the study of stability of genetic devices across generations by the 2015 University of Texas at Austin iGEM team. The plasmid has been observed be remain genetically stable across one-hundred generations. false false _2044_ 22564 27789 9 false The plasmid was constructed and cloned from parts from the Biobrick registry. false Devin Wehle component2452985 1 BBa_E0030 component2452981 1 BBa_J23110 component2452983 1 BBa_B0032 annotation2452983 1 BBa_B0032 range2452983 1 44 56 annotation2452985 1 BBa_E0030 range2452985 1 63 785 annotation2452981 1 BBa_J23110 range2452981 1 1 35 BBa_E0030 1 eyfp enhanced yellow fluorescent protein derived from A. victoria GFP 2004-03-02T12:00:00Z 2015-08-31T04:07:25Z Modificaitons to Clontech EYFP by Reshma Shetty Released HQ 2013 -- No description -- false false _1_ 0 24 7 In stock false true Caitlin Conboy and Jennifer Braff BBa_B0032 1 BBa_B0032 RBS.3 (medium) -- derivative of BBa_0030 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Weak1 RBS based on Ron Weiss thesis. Strength is considered relative to <bb_part>BBa_B0030</bb_part>, <bb_part>BBa_B0031</bb_part>, <bb_part>BBa_B0033</bb_part>. false true _41_44_48_46_1_ 0 24 7 In stock false Varies from -6 to +1 region from original sequence to accomodate BioBricks suffix (&quot;RBS-2&quot; in figure 4-14 of thesis). <P> Contact info for this part: <a href="mailto:(bchow@media.mit.edu)">Brian Chow</a> true Vinay S Mahajan, Voichita D. Marinescu, Brian Chow, Alexander D Wissner-Gross and Peter Carr IAP, 2003. annotation7027 1 BBa_B0032 range7027 1 1 13 annotation1710 1 RBS range1710 1 7 10 annotation1709 1 RBS-3\Weak range1709 1 1 13 BBa_K1627009_sequence 1 tttacggctagctcagtcctaggtacaatgctagctactagagtcacacaggaaagtactagatggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaataa BBa_B0032_sequence 1 tcacacaggaaag BBa_E0030_sequence 1 atggtgagcaagggcgaggagctgttcaccggggtggtgcccatcctggtcgagctggacggcgacgtaaacggccacaagttcagcgtgtccggcgagggcgagggcgatgccacctacggcaagctgaccctgaagttcatctgcaccaccggcaagctgcccgtgccctggcccaccctcgtgaccaccttcggctacggcctgcaatgcttcgcccgctaccccgaccacatgaagctgcacgacttcttcaagtccgccatgcccgaaggctacgtccaggagcgcaccatcttcttcaaggacgacggcaactacaagacccgcgccgaggtgaagttcgagggcgacaccctggtgaaccgcatcgagctgaagggcatcgacttcaaggaggacggcaacatcctggggcacaagctggagtacaactacaacagccacaacgtctatatcatggccgacaagcagaagaacggcatcaaggtgaacttcaagatccgccacaacatcgaggacggcagcgtgcagctcgccgaccactaccagcagaacacccccatcggcgacggccccgtgctgctgcccgacaaccactacctgagctaccagtccgccctgagcaaagaccccaacgagaagcgcgatcacatggtcctgctggagttcgtgaccgccgccgggatcactctcggcatggacgagctgtacaagtaataa BBa_J23110_sequence 1 tttacggctagctcagtcctaggtacaatgctagc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z