BBa_K163002 1 BBa_K163002 Mussel adhesive protein from Mytilus Edulis (Mefp-5) optimized for E. coli 2008-08-24T11:00:00Z 2015-05-08T01:10:55Z Waite, et al. "Polyphosphoprotein from the adhesive pads of Mytilus edulis" Biochemistry 40 (9), 2887-2893 (2001). Nucleotide sequence from GeneBank, accession number AF333078 This is the protein Mefp-5 that is secreted by Mytilus Edulis. Mefp-5 is one of the strongest adhesives naturally created, and a powerful anti-biofouling agent. The DNA has been codon optimized for use in E. coli using open-software codon-optimizer at http://genomes.urv.es/OPTIMIZER/. This gene lacks a promoter sequence. false false _261_ 0 2866 9 Not in stock false This sequence has been codon-optimized for production in E. coli. Mefp-5 contains over 20% molar concentration of L-DOPA, the highest DOPA content of known adhesive proteins secreted by Mytilus Edulis. Mefp-5 also has strong anti-biofouling properties, that could possibly be utilized by such things like pacemakers or heart monitors. Mefp-5 is difficult to obtain from purification of mussel proteins, so being able to obtain Mefp-5 from genetic engineering methods will allow researchers to better learn its properties. false Nora Yucel annotation1980425 1 Suffix range1980425 1 317 343 annotation1980424 1 Mefp-5 E. coli range1980424 1 23 316 annotation1980423 1 Start range1980423 1 23 25 annotation1980422 1 Prefix range1980422 1 1 20 BBa_K163002_sequence 1 gaattcgcggccgcttctaggcatgaagcttagctgcatcgttctggttctgtttctggtcaccctggcggcgtatagcgatgtgggttcttcgtcttccgaagagtataaaggcggttactacccaggtaacgcttaccactaccacagcggcggttcctaccacggcagcggttaccacggcggttacaaagggaagtattacggcaaagccaaaaaatactactacaaatacaagaactccggcaaatacaaatacctgaaaaaagctcgtaaatatcaccgtaaaggttataagtactacggtggtagtagctactagtagcggcggctccagagatct igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z