BBa_K1631000 1 BBa_K1631000 Translational unit of Barnase 2015-09-11T11:00:00Z 2015-09-14T07:28:13Z BBa_I7161211 This part is improvement of BBa_I716211. We added a start codon and charactarized it. If you want to know more detail, visit our wiki. Barnase is a RNase from Bacillus amyloliquefaciens. Its cytotoxity can be neutralized by immunity protein called Barstar (BBa_). This coding sequence only contains cataritic domain (not include extracellular translocation signal peptide of Bacillus amyloliquefaciens). false false _2048_ 23567 23567 9 false adding start codon false Yuto Yamanaka annotation2452447 1 Barnase catalitic domain ( I716211 ) range2452447 1 16 348 annotation2455461 1 BBa_B0034 range2455461 1 1 12 annotation2452453 1 ATG Start Codon range2452453 1 13 15 BBa_K1631000_sequence 1 aaagaggagaaaatggcacaggttatcaacacgtttgacggggttgcggattatcttcagacatatcataagctacctgataattacattacaaaatcagaagcacaagccctcggctgggtggcatcaaaagggaaccttgcagacgtcgctccggggaaaagcatcggcggagacatcttctcaaacagggaaggcaaactcccgggcaaaagcggacgaacatggcgtgaagcggatattaactatacatcaggcttcagaaattcagaccggattctttactcaagcgactggctgatttacaaaacaacggaccattatcagacctttacaaaaatcagataa igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z