BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K1631004 1 BBa_K1631004 Tlanslational unit of Immunity protein for Colicin-E3 2015-09-12T11:00:00Z 2015-09-13T12:52:31Z pColE3-CA38 Immunity protein for Colicin-E3 binds in between the Translocation domain and Ctalitic domain. Curiously, immunity protein does not block the active site.[1] It is considered that immunity protein blocks access of this enzyme to the ribosome. Colicins are a cytotoxins which are released to environment and kill other related strains. false false _2048_ 23567 23567 9 false none false Yuto Yamanaka annotation2453061 1 Colicin Immunity protein range2453061 1 13 270 annotation2453060 1 BBa_B0034 range2453060 1 1 12 BBa_K1631006 1 BBa_K1631006 rbs - Immunity protein of Colicin-E3 - d.term 2015-09-13T11:00:00Z 2015-09-14T03:36:51Z Assembly This part is a composite part of Translational unit of Colicin Immunity protein(BBa_K1631004) and double termnator (BBa_B0015). false false _2048_ 23567 23567 9 false none false Yuto Yamanaka component2453912 1 BBa_B0015 component2453905 1 BBa_K1631004 annotation2453912 1 BBa_B0015 range2453912 1 279 407 annotation2453905 1 BBa_K1631004 range2453905 1 1 270 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation4184 1 stem_loop range4184 1 12 55 annotation7018 1 BBa_B0010 range7018 1 1 80 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1631004_sequence 1 aaagaggagaaaatgggtctgaaactggacctgacctggttcgacaaatctaccgaagacttcaaaggtgaagaatactctaaagacttcggtgacgacggttctgttatggaatctctgggtgttccgttcaaagacaacgttaacaacggttgcttcgacgttatcgcggaatgggttccactactacagccgtacttcaaccaccagatcgacatctctgacaacgaatacttcgtttctttcgactaccgtgacggtgactggtaa BBa_K1631006_sequence 1 aaagaggagaaaatgggtctgaaactggacctgacctggttcgacaaatctaccgaagacttcaaaggtgaagaatactctaaagacttcggtgacgacggttctgttatggaatctctgggtgttccgttcaaagacaacgttaacaacggttgcttcgacgttatcgcggaatgggttccactactacagccgtacttcaaccaccagatcgacatctctgacaacgaatacttcgtttctttcgactaccgtgacggtgactggtaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z