BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation1999 1 lac O1 range1999 1 3 19 annotation2002 1 -10 range2002 1 43 48 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation2001 1 lac O1 range2001 1 26 42 annotation2000 1 -35 range2000 1 20 25 BBa_K1631003 1 BBa_K1631003 Tlanslational unit of Colicin Lysis Protein (for colicin-E3) 2015-09-12T11:00:00Z 2015-09-18T06:28:24Z pColE3-CA38 Colicin lysis protein allows colicins to be released. The mechanism how the colicin lysis protein allows colicin release has not been fully elucidated, but it is sure that this protein raise membrane permiability and cause quasilysis.[1] Colicins are a cytotoxins which are released to environment and kill other related strains. false false _2048_ 23567 23567 9 false none false Yuto Yamanaka annotation2453045 1 BBa_B0034 range2453045 1 1 12 annotation2453046 1 Colicin Lysis Protein range2453046 1 13 156 BBa_K1631011 1 BBa_K1631011 Plac Colicin Lysis protein 2015-09-13T11:00:00Z 2015-09-14T07:40:25Z assembly This is a generator of Colicin Lysisi Protein(BBa_K1631003), under the lac promoter. IPTG induction cause quasi-lysis[1] false false _2048_ 23567 23567 9 false none false Yuto Yamanaka component2455517 1 BBa_K1631010 component2455502 1 BBa_R0011 annotation2455517 1 BBa_K1631010 range2455517 1 64 356 annotation2455502 1 BBa_R0011 range2455502 1 1 54 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K1631010 1 BBa_K1631010 rbs - Colicin Lysis Protein - d.term 2015-09-13T11:00:00Z 2015-09-14T07:34:15Z Assembly This part is a composite part of Translational unit of colicin lysis protein(BBa_K1631003) and double termnator (BBa_B0015). false false _2048_ 23567 23567 9 false none false Yuto Yamanaka component2455501 1 BBa_B0015 component2455494 1 BBa_K1631003 annotation2455501 1 BBa_B0015 range2455501 1 165 293 annotation2455494 1 BBa_K1631003 range2455494 1 1 156 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1631010_sequence 1 aaagaggagaaaatgaaaaaaatcaccggtatcatcctactactgctggcagttatcatcctgtctgcatgccaggcgaactacatccgtgacgttcagggtggtacagtttctccatcttctaccgcggaagttaccggtctagcaactcagtaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1631003_sequence 1 aaagaggagaaaatgaaaaaaatcaccggtatcatcctactactgctggcagttatcatcctgtctgcatgccaggcgaactacatccgtgacgttcagggtggtacagtttctccatcttctaccgcggaagttaccggtctagcaactcagtaa BBa_K1631011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagaaagaggagaaaatgaaaaaaatcaccggtatcatcctactactgctggcagttatcatcctgtctgcatgccaggcgaactacatccgtgacgttcagggtggtacagtttctccatcttctaccgcggaagttaccggtctagcaactcagtaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z