BBa_K1631003 1 BBa_K1631003 Tlanslational unit of Colicin Lysis Protein (for colicin-E3) 2015-09-12T11:00:00Z 2015-09-18T06:28:24Z pColE3-CA38 Colicin lysis protein allows colicins to be released. The mechanism how the colicin lysis protein allows colicin release has not been fully elucidated, but it is sure that this protein raise membrane permiability and cause quasilysis.[1] Colicins are a cytotoxins which are released to environment and kill other related strains. false false _2048_ 23567 23567 9 false none false Yuto Yamanaka annotation2453045 1 BBa_B0034 range2453045 1 1 12 annotation2453046 1 Colicin Lysis Protein range2453046 1 13 156 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916612 1 BBa_B0012 component1916610 1 BBa_B0010 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation1686 1 T7 TE range1686 1 8 27 annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 BBa_K1631015 1 BBa_K1631015 Colicin Lysis Protein Generator (medium, constitutive) 2015-09-13T11:00:00Z 2015-09-14T08:05:50Z Assembly Colicin Lysis Protein under constitutive promoter BBa_J23106. false false _2048_ 23567 23567 9 false none false Yuto Yamanaka component2455571 1 BBa_K1631010 component2455560 1 BBa_J23106 annotation2455571 1 BBa_K1631010 range2455571 1 44 336 annotation2455560 1 BBa_J23106 range2455560 1 1 35 BBa_J23106 1 BBa_J23106 constitutive promoter family member 2006-08-13T11:00:00Z 2015-08-31T04:08:40Z Isolated from library of promoters Released HQ 2013 Later false true _52_ 0 483 95 In stock true N/A true John Anderson BBa_K1631010 1 BBa_K1631010 rbs - Colicin Lysis Protein - d.term 2015-09-13T11:00:00Z 2015-09-14T07:34:15Z Assembly This part is a composite part of Translational unit of colicin lysis protein(BBa_K1631003) and double termnator (BBa_B0015). false false _2048_ 23567 23567 9 false none false Yuto Yamanaka component2455494 1 BBa_K1631003 component2455501 1 BBa_B0015 annotation2455501 1 BBa_B0015 range2455501 1 165 293 annotation2455494 1 BBa_K1631003 range2455494 1 1 156 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K1631015_sequence 1 tttacggctagctcagtcctaggtatagtgctagctactagagaaagaggagaaaatgaaaaaaatcaccggtatcatcctactactgctggcagttatcatcctgtctgcatgccaggcgaactacatccgtgacgttcagggtggtacagtttctccatcttctaccgcggaagttaccggtctagcaactcagtaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1631010_sequence 1 aaagaggagaaaatgaaaaaaatcaccggtatcatcctactactgctggcagttatcatcctgtctgcatgccaggcgaactacatccgtgacgttcagggtggtacagtttctccatcttctaccgcggaagttaccggtctagcaactcagtaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1631003_sequence 1 aaagaggagaaaatgaaaaaaatcaccggtatcatcctactactgctggcagttatcatcctgtctgcatgccaggcgaactacatccgtgacgttcagggtggtacagtttctccatcttctaccgcggaagttaccggtctagcaactcagtaa BBa_J23106_sequence 1 tttacggctagctcagtcctaggtatagtgctagc BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z