BBa_R0011 1 lacI+pL Promoter (lacI regulated, lambda pL hybrid) 2003-01-31T12:00:00Z 2015-05-08T01:14:14Z represillator of Elowitz and Leibler (2000) Released HQ 2013 Inverting regulatory region controlled by LacI (<bb_part>BBa_C0010</bb_part>, <bb_part>BBa_C0011</bb_part>, etc.) <p> The PLlac 0-1 promoter is a hybrid regulatory region consisting of the promoter P(L) of phage lambda with the cI binding sites replaced with lacO1. The hybrid design allows for strong promotion that can nevertheless be tightly repressed by LacI, the Lac inhibitor (i.e. repressor) (<bb_part>BBa_C0010</bb_part>) ([LUTZ97]). The activity of the promoter can be regulated over a >600-fold range by IPTG in E.Coli DH5-alpha-Z1 (same paper reference). false true _1_ 0 24 7 In stock false <P> <P>hybrid promoter design to create strong promoter that is, at the same time, highly repressible. note that the upstream operator installed in this hybrid is slightly different than the one in the original source (Lutz and Bujard, 1997). the most upstream operator region is slightly truncated in the represillator version, so that both operators in the hybrid are the same sequence. see references for details. also, the sequence has been truncated after the transcriptional start site.<P>LacI binds to this regulator. This part is incompatible with species containing active LacI coding regions. Lactose and IPTG disable the operation of LacI and increase transcription. This part is incompatible with environments containing lactose or lactose analogs. true Neelaksh Varshney, Grace Kenney, Daniel Shen, Samantha Sutton annotation1999 1 lac O1 range1999 1 3 19 annotation2002 1 -10 range2002 1 43 48 annotation7064 1 BBa_R0011 range7064 1 1 54 annotation2001 1 lac O1 range2001 1 26 42 annotation2000 1 -35 range2000 1 20 25 BBa_B0012 1 BBa_B0012 TE from coliphageT7 2003-01-31T12:00:00Z 2015-08-31T04:07:20Z Derived from the TE terminator of T7 bacteriophage between Genes 1.3 and 1.4 <genbank>V01146</genbank>. Released HQ 2013 Transcription terminator for the <i>E.coli</i> RNA polymerase. false false _1_ 0 24 7 In stock false <P> <P>Suggested by Sri Kosuri and Drew Endy as a high efficiency terminator. The 5' end cutoff was placed immediately after the TAA stop codon and the 3' end cutoff was placed just prior to the RBS of Gene 1.4 (before AAGGAG).<P> Use anywhere transcription should be stopped when the gene of interest is upstream of this terminator. false Reshma Shetty annotation7020 1 BBa_B0012 range7020 1 1 41 annotation1687 1 stop range1687 1 34 34 annotation1690 1 polya range1690 1 28 41 annotation1686 1 T7 TE range1686 1 8 27 BBa_B0010 1 BBa_B0010 T1 from E. coli rrnB 2003-11-19T12:00:00Z 2015-08-31T04:07:20Z Transcriptional terminator consisting of a 64 bp stem-loop. false false _1_ 0 24 7 In stock false true Randy Rettberg annotation7018 1 BBa_B0010 range7018 1 1 80 annotation4184 1 stem_loop range4184 1 12 55 BBa_K1631007 1 BBa_K1631007 rbs - Barstar - d.term 2015-09-13T11:00:00Z 2015-09-14T04:42:43Z Assembly This part is a composite part of Translational unit of Barstar(BBa_K1631005) and double termnator (BBa_B0015). false false _2048_ 23567 23567 9 false none false Yuto Yamanaka component2453955 1 BBa_K1631005 component2453962 1 BBa_B0015 annotation2453955 1 BBa_K1631005 range2453955 1 1 285 annotation2453962 1 BBa_B0015 range2453962 1 294 422 BBa_B0015 1 BBa_B0015 double terminator (B0010-B0012) 2003-07-16T11:00:00Z 2015-08-31T04:07:20Z Released HQ 2013 Double terminator consisting of BBa_B0010 and BBa_B0012 false true _1_ 0 24 7 In stock false true Reshma Shetty component1916610 1 BBa_B0010 component1916612 1 BBa_B0012 annotation1916612 1 BBa_B0012 range1916612 1 89 129 annotation1916610 1 BBa_B0010 range1916610 1 1 80 BBa_K1631005 1 BBa_K1631005 Translational unit of Barstar (Barnase immunity protein) 2015-09-13T11:00:00Z 2015-09-14T03:19:43Z Bacillus amyloliquefaciens Barstar is a immunity protein of Barnase, RNase form Bacillus amyloliquefaciens. Barstar blocks the active site of barnase sterically[1]. Rference [1]Buckle, A. M., Schreiber, G., & Fersht, A. R. (1994). Protein-protein recognition: Crystal structural analysis of a barnase-barstar complex at 2.0-. ANG. resolution. Biochemistry, 33(30), 8878-8889. false false _2048_ 23567 23567 9 false none false Yuto Yamanaka annotation2453901 1 BBa_B0034 range2453901 1 1 12 annotation2453902 1 barstar range2453902 1 13 285 BBa_K1631023 1 BBa_K1631023 Plac -rbs- Barstar -d.term 2015-09-13T11:00:00Z 2015-09-18T06:25:53Z Assembly Barstar; Barnase immunity protein is under Plac(BBa_R0011) false false _2048_ 23567 23567 9 false none false Yuto Yamanaka component2455744 1 BBa_R0011 component2455759 1 BBa_K1631007 annotation2455759 1 BBa_K1631007 range2455759 1 64 485 annotation2455744 1 BBa_R0011 range2455744 1 1 54 BBa_B0010_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctc BBa_K1631023_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcacatactagagaaagaggagaaaatgaaaaaagcggttatcaacggtgaacagatccgttctatctctgacctgcaccagaccctgaaaaaagaactggcgctgccggaatactacggtgaaaacctggacgcgctgtgggactgcctgaccggttgggttgaatacccgctggttctggaatggcgtcagttcgaacagtctaaacagctgaccgaaaacggtgcggaatctgttctccaggttttccgtgaagcgaaagcggaaggttgcgacatcaccatcatcctgtcttaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1631007_sequence 1 aaagaggagaaaatgaaaaaagcggttatcaacggtgaacagatccgttctatctctgacctgcaccagaccctgaaaaaagaactggcgctgccggaatactacggtgaaaacctggacgcgctgtgggactgcctgaccggttgggttgaatacccgctggttctggaatggcgtcagttcgaacagtctaaacagctgaccgaaaacggtgcggaatctgttctccaggttttccgtgaagcgaaagcggaaggttgcgacatcaccatcatcctgtcttaatactagagccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata BBa_K1631005_sequence 1 aaagaggagaaaatgaaaaaagcggttatcaacggtgaacagatccgttctatctctgacctgcaccagaccctgaaaaaagaactggcgctgccggaatactacggtgaaaacctggacgcgctgtgggactgcctgaccggttgggttgaatacccgctggttctggaatggcgtcagttcgaacagtctaaacagctgaccgaaaacggtgcggaatctgttctccaggttttccgtgaagcgaaagcggaaggttgcgacatcaccatcatcctgtcttaa BBa_B0012_sequence 1 tcacactggctcaccttcgggtgggcctttctgcgtttata BBa_R0011_sequence 1 aattgtgagcggataacaattgacattgtgagcggataacaagatactgagcaca BBa_B0015_sequence 1 ccaggcatcaaataaaacgaaaggctcagtcgaaagactgggcctttcgttttatctgttgtttgtcggtgaacgctctctactagagtcacactggctcaccttcgggtgggcctttctgcgtttata igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z