BBa_K1633001 1 BBa_K1633001 MOR siRNA 2 2015-09-04T11:00:00Z 2015-09-13T02:07:48Z We designed the MOR siRNA-2 according to the DNA sequence of Mu receptor, and ordered the part from a DNA synthesis company. It is one kind of small interfering RNA. It is artificial designed to target and downregulate human Mu opioid receptor. We use them as siRNA medicine to downregulate the expression of Mu opioid receptor in brain tissue. true false _2050_ 24400 24400 9 false No details yet. false LI JIAHONG BBa_K1633001_sequence 1 tgaccaggaagtttccaaagagttttggccactgactgactctttggacttcctggtca igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z