BBa_K1634002 1 BBa_K1634002 pmyo2 ( a promoter in C.elegans ) 2015-09-12T11:00:00Z 2015-09-14T07:53:57Z We get Pmyo2 from the C.elegans' genomic DNA by PCR. Pmyo2 is a promoter which can drive the expression in the muscle of C.elegans especially the muscle in the head and pharynx.And we link the Pmyo2 with some channelrhodopsin which can be activated or supressed by the light. Since we have learned that the chosing of direction in C.elegans depends on the muscle in the head, we can observe the obvious change in moving pattern of the C.elegans after we shed the light. In other words,we can use them to construct a light-sensed locomotion controlling system in C.elegans. And we achieve that goal by using this part to control the movement of the head, the movement of the whole C.elegans. false false _2051_ 25024 24399 9 false Since we use the restriction enzyme site to do the ligation, we should pay attention to the sequence of Pmyo2, avoiding using the restriction site exits in it. false Xinhong Chen annotation2453209 1 pmyo2 range2453209 1 1 694 BBa_K1634002_sequence 1 tgctgaactttacaccccgaacagcaatgtgtgcttcagcctaaaaaaaagtaagtgtgttaatcagtgcccccgattcttcattttttgcccctctctcccgtttcgtcggcaaaagaagagaaaataaagataagtctcaagataggttggtaatcgctaaagtggttgtgtggataagagtagcaaaatggcaggaagagcactttgcgcgcacacactgtactcattgttctggataaaattctctcgttgtttgccgtcggatgtctgcctctctgcattgagccggcttcttcactatctttagttaacctaaaatgccgtttcttttctcgtatccccactatcccgttgaggttctctgctctcttcgctccctaccgccagcgagcaactatccgtgggggcgccttgctcggaagatgggggggaagaaagaagatttttgctatttgcacttgagaaagagacttttcctgcgtcgatggttagagaacagtgtgcagacacttttcagctacctagaattacaattggatatccccgcctcccaatccacccacccagggaaaaagaagggctcgccgaaaatcaaagttatctccaggctcgcgcatcccaccgagcggttgacttctctccaccacttttcattttaaccctcgatcgtcagacacagaaatggattacg igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z