BBa_K1634006 1 BBa_K1634006 dsRed ( a reporter which is a red fluorescent protein) 2015-09-13T11:00:00Z 2015-09-14T12:41:12Z DsRed is a commonly used reporter,so we get it from some plamids by PCR. DsRed is a commonly used fluorescent protein,a reporter.If we wanted to express some special protein such as channelrhodopsins in those muscle,we need to inject the mixtures containing the plasmid we constructed into the sexual gland of the C.elegans. Then we can get the transgenic descendants we want. However, this dosen't mean that we can get some successful transgenic descendants after every microinjection.So we need to pick up the several successful one from thousands of descendants .But sometimes the specific protein we express has not contained a reporter, and even though the ChR2 we express contains a YFP, the light is not strong enough for us to find the successful one from thousands of descendants. To solve this problem, we constructed this part, Pmyo2-dsRed ,which was called "the comarker"by us. We made mixture of Pmyo2-dsRed and Pmyo2-channelrhodopsin, then inject the mixture through microinjection. The possible red fluorescent in the descendants has 4 main functions. Firstly, it ensures that the microinjection process is successful. Secondly, it ensures that those plasmids has successfully passed to the descendants.Thirdly, since it has the same promoter as our target protein, we can assume that our target protein has also successfully expressed in the same position, and we can have a double-check if our protein\ has a reporter. Finally, it can also help us to learn the expression pattern and quantify the expression level roughly by observing the fluorescence intensity of dsRed. false false _2051_ 0 24399 24399 9 Not in stock false Since we use the restriction enzyme site to do the ligation, we should pay attention to the sequence of dsRed, avoiding using the restriction site exits in it. false Xinhong Chen annotation2453841 1 dsRed range2453841 1 1 678 BBa_K1634006_sequence 1 atggcctcctccgagaacgtcatcaccgagttcatgcgcttcaaggtgcgcatggagggcaccgtgaacggccacgagttcgagatcgagggcgagggcgagggccgcccctacgagggccacaacaccgtgaagctgaaggtgaccaagggcggccccctgcccttcgcctgggacatcctgtccccccagttccagtacggctccaaggtgtacgtgaagcaccccgccgacatccccgactacaagaagctgtccttccccgagggcttcaagtgggagcgcgtgatgaacttcgaggacggcggcgtggcgaccgtgacccaggactcctccctccaggacggctgcttcatctacaaggtgaagttcatcggcgtgaacttcccctccgacggccccgtgatgcagaagaagaccatgggctgggaggcctccaccgagcgcctgtacccccgcgacggcgtgctgaagggcgagacccacaaggccctgaagctgaaggacggcggccactacctggtggagttcaagtccatctacatggccaagaagcccgtgcagctgcccggctactactacgtggacgccaagctggacatcacctcccacaacgaggactacaccatcgtggagcagtacgagcgcaccgagggccgccaccacctgttcctgtag igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z