BBa_K1636002 1 BBa_K1636002 Linker 2015-09-04T11:00:00Z 2015-09-05T07:15:23Z This part was designed by the iGEM TecCEM team from scratch and is not based or does not come from any genome. This linker was designed by the iGEM TecCEM team in order to retrieve single-stranded oligonucleotides when produced as single-stranded genetic material (e.g. plasmid). The linker should be flanking said oligonucleotides, and given the design of its sequence, it is able to form a hairpin-like secondary structure that allows the usage of a restriction enzyme (MlyI from New England BIolabs) with a blunt cut thereby releasing the oligos of interest. false false _2053_ 25405 25405 9 false The design considerations of this linker included the ability of forming a stable hairpin-like secondary structure that provided with the enzyme restriction site of MlyI which could make a blunt cut without leaving scar on the oligonucleotides of interest. false Diana Monta??o, Alberto Cristerna, Jessica Avila, Ernesto Hernandez, Camila Martinez, Fernanda Sanchez, Roger Milton Rubio Sanchez, Ana Laura Torres BBa_K1636002_sequence 1 gcgcggactcgcgcgcgcgcgcgcgcttttgcgcgcgcgcgcgcgcgagtccgcgc igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z