BBa_K1638006 1 BBa_K1638006 10 aa linker with BamHI restriction site and TEV recognition site 2015-05-09T11:00:00Z 2015-05-10T03:03:51Z .. 10 amino acids linker with the sequence GSENLYFQSGG. false false _2055_ 26157 26157 9 false .. false Jens Sivk??r Pettersen annotation2431930 1 BamHI range2431930 1 1 6 annotation2431931 1 TEV recognition range2431931 1 7 27 BBa_K1638006_sequence 1 ggatccgaaaatttgtattttcaatctggt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z