BBa_K1639001 1 BBa_K1639001 Trigger RNA 2015-09-11T11:00:00Z 2015-09-18T06:50:31Z Wyss Institute for Biologically Inspired Engineering. Sequence is taken from supplementary data of article: "Toehold Switches: De-Novo-Designed Regulators of Gene Expression". (PMID: 25417166) This part required for producing reporter flourescence protein GFP from Toehold-GFP(BBa_K1639000) composite part. false false _2056_ 20835 20835 9 true This part synthetase with strong T7 Promoter downstream of Trigger RNA. There is also a T7 Terminator after Trigger RNA. false Mustafa Yılmaz annotation2452876 1 T7 Terminator range2452876 1 84 130 annotation2452875 1 Trigger RNA range2452875 1 22 83 annotation2452874 1 T7 Promoter range2452874 1 1 19 BBa_K1639001_sequence 1 gtaatacgactcactatagggactgactattctgtgcaatagtcagtaaagcagggataaacgagatagataagataagatagtagcataaccccttggggcctctaaacgggtcttgaggggttttttgt igem2sbol 1 iGEM to SBOL conversion Conversion of the iGEM parts registry to SBOL2.1 Chris J. Myers James Alastair McLaughlin 2017-03-06T15:00:00.000Z